Tmem184c (NM_145599) Mouse Untagged Clone

CAT#: MC219872

Tmem184c (untagged) - Mouse transmembrane protein 184C (Tmem184c), (10ug)

USD 794.00


Availability*
13 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tmem184c (NM_145599) Mouse Untagged Clone
Symbol Tmem184c
Synonyms 8430433H16Rik; AI645453; AL033298; BC004056; Tmem34
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC219872 representing NM_145599
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTTGCGCATGTAATCGGAGTAACTGGAGGAGATGGATCCGACCCCTGTTGGTACTTTTTTACGCAA
CAACCATCCTGGTCGCGGTTCCGATATGCATTTGGAAGTTTCAAAAAATGAAGGTTGGAATGCACACGAA
ATCCTGGTTTATAGCTGGAATATTTCTGCTGCTAACCATACCCGTGTCATTGTGGGGAATCCTTCAACAT
CTGGTACATTACACTCAACCTGAACTTCAAAAGCCCATAATAAGGATCCTATGGATGGTCCCAATATACA
GTGTGGATAGTTGGGTGGCCTTGGTATATCCCAAAATTGCAATATACGTGGATACCTGGAGGGAGTGTTA
CGAAGCTTACGTCATCTATAACTTTATGATCTTTCTTACCAACTATCTGACAATCCGATTCCCAAACTTG
ATATTACACCTCGAAGCGAAAGATCAACAAAACCACATCCTTCCGTTATGCTGCTGTCCACCGTGGGCGA
TGGGAGAAATGCTACTCTTTCGTTGCAAGCTAGGAGTGCTGCAATATACCGTGGTCAGACCGATCACCAC
CGTCACTGCACTCGTATGTGAAATCCTTGATGTATATGATGAAGGAAACTTTGGTTTCAGCAATGCTTGG
ACATACCTCGTTATACTAAATAATTTGTCACAATTGTTTGCCATGTACTGCCTGCTGCTGTTTTACAAAG
TCCTAAAGGAAGAGCTTAGCCCTATACAACCTGTTGGCAAGTTCCTCTGCGTAAAACTCGTGGTTTTCGT
TTCTTTTTGGCAAGCGGTACTTATTGCTTTGTTGGTTAAACTGGGCGTTATTTCAGAAAAGCGTACCTGG
GAATGGCAAAGTGCAGAAGCTGTGGCCACGGGCCTGCAGGATTTCATAATCTGCATTGAAATGTTCTTTG
CGGCAATTGCCCACCACTATACGTTCTCCTATAAACCCTATGTGCATGAAGCAGAGGAAGGCTCCTGCTT
TGACTCGTTTCTTGCAATGTGGGATGTGTCCGATATCAGAGATGATATTTCTGAACAAGTAAGGCGTGTC
GGGAGGACAATGAGAGGTTATCCAAAAAAGAAATGTTTTCCTGGAGATCCAGATCATAATGAGCACTCGA
GCCTACTTTCTTCTTCTTCACAAGATCTAACTTCTGGTTCTTCAAAGGTACCCTCCCCAGGGGGCCTGTA
CCAAGGTTTTGGACACACTATTTCTTCACAGAGCCCAATTTCTATAGCCAGCATATATGAAGAGATCATG
AATGACATCCCAGAAGAGCAACAGAAGCTTCTCAATCCCGGACAAGACGTCACGATCAACATCCCAGAAG
AGCAACAAAAACTTAACACAGGCAAGGATGTCATGCTTGACAGACAGACCATTACTTCACCGAGACCAAT
TTCTATAGCCAGCATATATGAAAAGATCATGATTGACATCCCAGAAGAGCAACAAAAACTTACTGACACA
GGCCAAGATGTCATGATTAACAGACAGACCATTACTCCACCGAGACCAATTTCTATAACCAGCATATATG
AAGAGGTCTTAATTGACATCACAGAAAAGCAACAAAAACTTAATGATACAGGCAAAAATGTCATGATTAA
CATCCCAGAAGAGCAACAAAAACTTATTGACAAACGCAAAGATGTCATGATTGACATCCCAGAACAGAAC
GCAATTCCTGATAATAGCCAATATCAAGACCAGGAACAAATAGTTACTTTACAGGCTTTATTTCCTTCAA
CAGAAACATCTGAAAATAGCATGATTGACACCTCGGAATCACAGCAGGAGTCTTCTGATTTATGTACCGA
ATCTTCTGATTCATCTACCGAGTCTTCTGACCTATCTACGGACCCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_145599
ORF Size 1869 bp
Insert Size 1869
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_145599.4, NP_663574
RefSeq Size 2701
RefSeq ORF 1869
Locus ID 234463
Cytogenetics 8|8 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.