Gbp5 (NM_153564) Mouse Untagged Clone

CAT#: MC219463

Gbp5 (untagged) - Mouse guanylate binding protein 5 (Gbp5), (10ug)

USD 752.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gbp5 (NM_153564) Mouse Untagged Clone
Symbol Gbp5
Synonyms 5330409J06Rik; Gbp5a
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC219463 representing NM_153564
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCCAGAGATTCACATGCCAGAACCCTTGTGCCTCATTGGGAGCACCGAGGGACACCTAGTAACTA
ACCAGGAAGCCCTGAAGATTCTGTCTGCCATCACACAGCCAGTGGTGGTGGTAGCCATTGTGGGTCTTTA
TCGCACAGGCAAATCCTACCTGATGAACAAGCTGGCTGGGAAGGAGAAGGGCTTTTCTGTTGGATCCACT
GTACAGTCTCACACCAAGGGGATCTGGATGTGGTGTGTGCCTCACCCCCAAAAGCCAGACCACACTTTGG
TTCTGCTTGACACTGAAGGCCTGGGAGATGTGGAGAAGGATGATAAAAAGAATGATACTCAGATCTTTGC
ACTAGCAATCCTCCTCAGTAGCACCTTTGTATACAACACTATGAACAAAATTGACCAGGGGGCTATCGAC
CTATTGCACAATGTGACAGAACTGACAGACTTGCTCCGGACAAGAAACTCCTCTGATTCTAATCAAACTG
AGGGTGAGGGACCTGCTGACATGAGCTTCTTCCCAGACTTGGTGTGGACTCTGAGAGATTTCTTCCTGGA
CCTGCAAGCCAATGGGCATGCCATCACATCAGATGAATATCTGGAGAATTCACTGAAGCTGAAGCAAGGT
AGCGATGAAAGAACTCAAACATTCAATCTACCGCGGCTGTGCATACAGAAGTTCTTCCCAGTAAAGAAAT
GCTTTGTTTTTGACGCTCCTGCGCTTGGAAGTAAGCTTTCCCAGCTTCCAACACTCAGCAACGAGGAGCT
GAACTCAGATTTTGTGCAGGACCTTTCAGAATTCTGTTCACACATCTTCACCCAATCTAAGACCAAGACT
CTTCCAGGAGGCATCCAGGTCAACGGACCTCGTCTAGAAAGCCTGGTGCTGACTTATGTCGATGCCATCA
ACAGCGGGGCTCTGCCTTCCATAGAGAACACAGTAGTAACCTTGGCCCGGAGGGAGAACTCTGCAGCAGT
TCAAAAGGCCATTGGTCACTACGATCAGCTGATGAGCGAGAAGGTGCAGCTGCCCACAGAGACCCTCCAG
GAGCTGCTGGACCTGCACCGGACCTGTGAGCGAGAGGCCATAGAAATCTTCAGGAAGCATTCGTTCAAGG
ATGAGGGTGAATTTTTCCAGAAAGAATTGGAGAGCCTACTAAGTGCAAAGCAGGATGAGATTTGTAAGAA
GAACGCGGATGCTTCTGCAGCCCTCTGCTCAACCCTACTTGGGAGTATTTTTAAGCCTCTGGAACAAGAA
GTGGCGCAGGAGTTCTATCATAAACCAGGAGGCCACAAGCTCTTCCTTCAGAGGATGGAACAGCTGAAGG
CAAATTACCGTCAGCAGCCAGGGAAGGGAACACAGGCTGAGGAAGTGCTGCAGACCTATTTGAACGCCAA
AGAAACAGTGAGCCGTACAATTCTACAAACAGACCAGGTTCTCACAGACAAGGAGATCCAGAGTAAAGCG
GAACAAGAAAGAGCAGAGGCTGCCCGGCTCGAAGCACAGAGGTTGGAGGCTATTCGCATCCAGGAAGAGC
AAAGGAAAGCAGAGATGGAGAGACAGCATCAAGAGCAATTGAGGCAAATAGCATTGGAGAAGGCAAGAGT
TGCACAAGAGCAACAGTGGATCCTGAAGCAGAGAGCCCAGGAAGAGGCTGATAGAATCAAGGCAGAGCAG
GAAGCTCAACTCAGAGCACTTCAACAGCAGCTCCAACACATGAGGGAAATGAACCACCACCGTAGACATC
ATCATGACTGTGTTATAAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_153564
ORF Size 1773 bp
Insert Size 1773
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_153564.2, NP_705792
RefSeq Size 3021
RefSeq ORF 1773
Locus ID 229898
Cytogenetics 3|3 H1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.