Ddi2 (BC031491) Mouse Untagged Clone

CAT#: MC218404

Ddi2 (untagged) - Mouse DNA-damage inducible protein 2 (cDNA clone MGC:27896 IMAGE:3499157), (10ug)

USD 691.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ddi2 (BC031491) Mouse Untagged Clone
Symbol Ddi2
Synonyms 9130022E05Rik
Vector pCMV6-Entry
Sequence Data
>BC031491
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCATCATTGCCGACTTCAGATGGGTTTGACCATCCAGCTCCTTCAGGGCAGAGTCCTGAGGTTGGTA
GCCCGACGAGTCTCGCTCGCTCTGTTTCTGCTTCCGTCTGCGCCATCAAGCCCGGTGACCCCAATAGCAT
TGAATCTCTAGCTATGGAGGCTACGAAGGCTTCAGCTGAATTCCAGACAAACTCTAAGAAAACAGACCCT
CCTCCTCTGCAGGTTCTTCCTGACCTTGCTTCCTCAGCAGAGCAGAGTCTAGCCATGCCTTTCCATAAGT
CATCAAAAGAAGCCGTTGTTGCAGGTAATCTGGAGAAATCTGTTGAGAAAGGAACCCAGGGCCTCAGAGT
GTATCTCCACACAAGACAGGACGCTAGTTTAACTCTCACAACTACTGGGATGCGGGAGCCACAGATATTT
GCGGAGGAAAAGAGTTGGCATCCAGAAAATCAGACCCCAAGTCCCGTGAACGGCCTTCAGCAGCACAGAG
AAACAGGGAGTGTACAGCGAGAGGCTGGACAGCAGAGTGTTCCACAGGACCAGGGCTGTCTTTGTGACGC
AGAAGACCTTGAGCTTCATGAAGAAGTTGTCAGTTTGGAAGCTCTGAGGAAAGGTGAGCTACAAAGACAC
GCTCATCTTCCCAGTGCAGAGAAGGGTCTTCCAGCTTCAGGACTCTGTAGCTGTCCATGCTCAGAAGCCC
TGATGGAAGTAGATACAGCTGAACAGTCTCTGGTTGCTATGTGCAGCTCAACAGGCAGGCAGGATGCCGT
CATCAAGAGCCCTAGTGTAGCACATCTCGCTTCAGATAATCCCACTATGGAAGTGGAGACATTACAGTCT
AACCCGTCCTGTGAGCCTGTGGAACATTCCATCTTGACTCGGGAATTGCAGCTCCCAGAAGATAATGTTG
ACATGTCTACAATGGATAACAAAGATGACAATTCCTCTTCCCTTCTAAGTGGCCACGGTCAGCCCTCTGT
GGAATCAGCAGAAGAATTTTGTTCATCTGTCACAGTGGCCTTGAAAGAACTCCATGAGCTTTTGGTCATT
AGCTGTAAGCCAGCTTCAGAAGAGTCACCTGAGCATGTTACCTGTCAGTCAGAGATAGGAGCTGAGAGCC
AACCAAGTGTTTCAGACCTTTCAGGAAGAAGGGTCCAAAGTGTGCATTTGACCCCTAGTGACCAGTACTC
ACAAGGCTCCTGTCACCAGGCCACCTCTGAATCAGGAAAGACAGAAATCGTAGGAACTGCCCCTTGTGCT
GCGGTAGAAGATGAAGCATCCACTAGCTTTGAAGGTCTGGGTGATGGCTTGTCACCTGACCGAGAAGATG
TCCGCAGATCAACAGAGTCAGCCAGGAAGAGCTGTTCTGTCGCCATAACCTCAGCTAAACTGTCTGAGCA
GTTGCCCTGCACCTCAGGGGTAGAAATAGCACCTGAACTTGCAGCAAGTGAGGGTGCCCACAGTCAGCCT
TCAGAGCATGTGCATAATCCAGGCCCAGACAGGCCGGAGACCAGCAGTGTCTGCCCTGGAGCTGGGTTGC
CCCGTAGTGGATTGGACCAACCTCCCACACAGTCCTTGTCCACCCCCTCCGTTCTTCCACCGTTCATCTT
TCCTGCTGCAGATGTTGACAGGATTCTTGGTGCCGGCTTCACTCTGCAGGAAGCGCTCGGGGCTCTGCAT
CGAGTTGGTGGGAATGCAGACCTTGCCCTTCTTGTTTTGTTAGCAAAGAACATTGTAGTCCCAACATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC031491
ORF Size 1146 bp
Insert Size 1146
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC031491,
RefSeq Size 2307
RefSeq ORF 1146
Locus ID 68817
Cytogenetics 4|4 E1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.