Amy2a4 (NM_001160150) Mouse Untagged Clone

CAT#: MC217252

Amy2a4 (untagged) - Mouse amylase 2a4 (Amy2a4), (10ug)

USD 649.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Amy2a4 (NM_001160150) Mouse Untagged Clone
Symbol Amy2a4
Synonyms ENSMUSG00000074267; mAmy2-3; OTTMUSG00000022433
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC217252 representing NM_001160150
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTTCGTTCTGCTGCTTTCCCTCATTGGGTTCTGCTGGGCTCAATATGACCCACATACTTCAGATG
GGAGGACTGCTATTGTCCACCTGTTCGAGTGGCGCTGGGTTGATATTGCCAAGGAATGTGAGCGATACTT
AGCTCCTAAGGGATTTGGAGGGGTGCAGGTCTCTCCACCCAATGAAAACGTTGTAGTTCATAACCCATCA
AGACCTTGGTGGGAAAGATACCAACCAATCAGCTATAAAATCTGCACAAGGTCTGGAAATGAAGATGAAT
TCAGAGACATGGTGACAAGGTGCAACAATGTTGGTGTCCGTATTTATGTGGATGCTGTCATTAACCACAT
GTGTGGCGCAGGCAATCCTGCAGGAACAAGCAGTACCTGTGGAAGTTACCTCAATCCAAATAACAGGGAA
TTCCCAGCAGTTCCATACTCTGCTTGGGACTTTAACGATAATAAATGTAATGGAGAAATTGATAACTACA
ATGATGCTTATCAGGTCAGAAATTGTCGTCTGACTGGCCTTCTGGATCTTGCACTTGAGAAAGATTATGT
TCGTACCAAGGTGGCTGACTATATGAACCATCTCATTGACATTGGAGTAGCAGGGTTCAGACTTGATGCT
GCTAAGCACATGTGGCCTGGAGACATAAAGGCAGTTTTGGACAAACTGCATAATCTCAATACAAAATGGT
TCTCCCAAGGAAGCAGACCTTTCATTTTCCAAGAGGTCATTGATCTGGGTGGTGAGGCAATTAAAGGTAG
TGAGTACTTTGGAAATGGCCGTGTGACAGAATTCAAGTATGGTGCAAAACTTGGCACAGTTATCCGCAAG
TGGAATGGCGAGAAGATGTCCTATTTAAAGAACTGGGGAGAAGGTTGGGGTTTGGTGCCTTCTGACAGAG
CCCTTGTGTTTGTGGACAACCATGATAATCAGCGAGGACATGGTGCTGGAGGATCATCCATCCTGACATT
CTGGGATGCTAGAATGTATAAAATGGCTGTCGGATTTATGTTGGCTCATCCTTATGGATTCACAAGAGTA
ATGTCAAGTTACCGTTGGAATAGAAATTTCCAGAATGGAAAAGATCAGAATGACTGGATTGGACCACCCA
ATAACAATGGAGTAACAAAAGAAGTGACCATTAATGCAGACACTACTTGTGGCAATGACTGGGTCTGTGA
ACACAGATGGCGTCAAATCAGGAACATGGTTGCCTTCAGGAATGTGGTCAATGGTCAGCCTTTTTCAAAC
TGGTGGGATAATAACAGCAACCAAGTAGCTTTTAGCAGAGGAAACAGAGGATTCATTGTCTTTAACAATG
ATGACTGGGCTTTGTCAGCCACTTTACAGACTGGTCTTCCTGCTGGCACATACTGTGATGTCATCTCTGG
AGATAAGGTCGATGGCAATTGCACTGGACTTAGAGTGAATGTTGGCAGTGATGGCAAAGCTCACTTTTCC
ATTAGTAACTCTGCTGAGGACCCATTTATTGCAATCCATGCTGACTCAAAATTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001160150
ORF Size 1527 bp
Insert Size 1527
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001160150.1, NP_001153622
RefSeq Size 3723
RefSeq ORF 1527
Locus ID 100043684
Cytogenetics 3 F3|3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.