Mief1 (NM_178719) Mouse Untagged Clone

CAT#: MC216374

Smcr7l (untagged) - Mouse Smith-Magenis syndrome chromosome region, candidate 7-like (human) (Smcr7l), (10ug)


  "NM_178719" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Mief1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mief1
Synonyms A230016E22; AI452372; Smcr7l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216374 representing NM_178719
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGCGCTGGTGAGCGCAAAGGGAAGAAGGATGACAATGGCATTGGTACGGCCATCGATTTTGTGC
TCTCCAATGCCCGGCTGGTGCTGGGTGTGGGTGGAGCAGCTATGTTGGGCATCGCCACACTGGCAGTTAA
GCGGATGTATGACCGGGCAATCAGTGCCCCTACCAGCCCTACCCGCCTAAGCCATTCAGGGAAGAGGAGC
TGGGAGGAGCCAAACTGGATGGGCTCTCCTCGCCTATTGAACAAGGACATGAAGGCAGGCCTGAGCCGGT
CCCTGCAGACCCTTCCCACAGACTCTTCTGCCTTTGACACAGATACATTCTGCCCACCCCGGCCCAAACC
ATTGGCCAGGAGGGGCCAGGTAGACTTGAAGAAGTCACGACTCCGCATGTCCCTGCAGGAGAAACTTCTT
TCTTACTACCGGAACCGGGCAGCCATCCCTGCTGGAGAGCAGGCTCGGGCCAAGCAAGCTGCGGTGGACA
TATGTGCTGAGCTCCGGAGCTTCCTGCGGGCCAAGCTGCCTGATATGCCACTTCGGGACATGTACTTGAG
TGGCAGCCTCTATGATGATCTGCAGGTGGTGACGGCTGACCATATCCAACTCATTGTCCCCCTTGTGCTG
GAGCAGAACCTGTGGTCATGCATACCTGGGGAGGACACCATCATGAATGTCCCTGGTTTCTTCCTGGTTC
GTCGTGAGAACCCAGAGTACTTTCCTCGTGGTAGCAGTTATTGGGACCGATGTGTTGTAGGTGGCTACCT
CTCCCCAAAGACAGTGGCAGACACCTTTGAGAAAGTGGTGGCAGGCTCCATCAACTGGCCAGCCATAGGG
TCCCTCTTAGACTATGTGATCCGACCAGCACCACCCCCAGAGGCCCTGACACTAGAAGTTCAGTATGAGA
AGGACAAACATCTTGTCATTGACTTCCTGCCATCAGTAACCCTTGGTGACACTGTCTTGGTGGCCAGACC
ACACCGGTTAGCTCAGTATGACAACCTGTGGCGGCTGAGCCTTCGTCCTGCTGAGACAGCACGCTTACGG
GCTTTGGACCAGGCGGACTCCGGCTGCCGGTCTCTTTGCCTCAAGATCCTCAAGGCCATATGCAAGTCCA
CTCCAGCTCTGGGCCACCTCACTGCCAGCCAGCTAACCAACGTCATCCTCCACTTGGCCCAGGAGGAGGC
TGACTGGTCTCCAGACATGTTGGCTGACCGCTTTCTACAGGCCCTGAGGGGACTCATCAGCTACTTGGAG
GCTGGGGTCTTGCCCAGTGCCCTGAACCCTAAGGTGAACCTATTTGCAGAGCTCACCCCTCAAGAAATAG
ACGAGTTGGGATATACCCTCTACTGCTCACTGTCTGAGCCGGAGGTGCTGCTGCAGACGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_178719
Insert Size 1392 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC137633, AAI37634
RefSeq Size 3281 bp
RefSeq ORF 1392 bp
Locus ID 239555
UniProt ID Q8BGV8
Cytogenetics 15 E1
Gene Summary Mitochondrial outer membrane protein which regulates mitochondrial fission. Promotes the recruitment and association of the fission mediator dynamin-related protein 1 (DNM1L) to the mitochondrial surface independently of the mitochondrial fission FIS1 and MFF proteins. Regulates DNM1L GTPase activity and DNM1L oligomerization. Binds ADP and can also bind GDP, although with lower affinity. Does not bind CDP, UDP, ATP, AMP or GTP. Inhibits DNM1L GTPase activity in the absence of bound ADP. Requires ADP to stimulate DNM1L GTPase activity and the assembly of DNM1L into long, oligomeric tubules with a spiral pattern, as opposed to the ring-like DNM1L oligomers observed in the absence of bound ADP. Does not require ADP for its function in recruiting DNM1L.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.