Rxra (NM_011305) Mouse Untagged Clone

CAT#: MC216284

Rxra (untagged) - Mouse retinoid X receptor alpha (Rxra), (10ug)


  "NM_011305" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rxra"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rxra
Synonyms 9530071D11Rik; Nr2b1; RXRalpha1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_011305, the custom clone sequence may differ by one or more nucleotides


ATGGACACCAAACATTTCCTGCCGCTCGACTTCTCTACCCAGGTGAACTCTTCGTCCCTCAACTCTCCAA
CGGGTCGAGGCTCCATGGCTGTCCCCTCGCTGCACCCCTCCTTGGGTCCGGGAATCGGCTCTCCACTGGG
CTCGCCTGGGCAGCTGCACTCTCCTATCAGCACCCTGAGCTCCCCCATCAATGGCATGGGTCCGCCCTTC
TCTGTCATCAGCTCCCCCATGGGCCCGCACTCCATGTCGGTACCCACCACACCCACATTGGGCTTCGGGA
CTGGTAGCCCCCAGCTCAATTCACCCATGAACCCTGTGAGCAGCACTGAGGATATCAAGCCGCCACTAGG
CCTCAATGGCGTCCTCAAGGTTCCTGCCCATCCCTCAGGAAATATGGCCTCCTTCACCAAGCACATCTGT
GCTATCTGTGGGGACCGCTCCTCAGGCAAACACTATGGGGTATACAGTTGTGAGGGCTGCAAGGGCTTCT
TCAAGAGGACAGTACGCAAAGACCTGACCTACACCTGCCGAGACAACAAGGACTGCCTGATCGACAAGAG
ACAGCGGAACCGGTGTCAGTACTGCCGCTACCAGAAGTGCCTGGCCATGGGCATGAAGCGGGAAGCTGTG
CAGGAGGAGCGGCAGCGGGGCAAGGACCGGAATGAGAACGAGGTGGAGTCCACCAGCAGTGCCAACGAGG
ACATGCCTGTAGAGAAGATTCTGGAAGCCGAGCTTGCTGTCGAGCCCAAGACTGAGACATACGTGGAGGC
AAACATGGGGCTGAACCCCAGCTCACCAAATGACCCTGTTACCAACATCTGTCAAGCAGCAGACAAGCAG
CTCTTCACTCTTGTGGAGTGGGCCAAGAGGATCCCACACTTTTCTGAGCTGCCCCTAGACGACCAGGTCA
TCCTGCTACGGGCAGGCTGGAACGAGCTGCTGATCGCCTCCTTCTCCCACCGCTCCATAGCTGTGAAAGA
TGGGATTCTCCTGGCCACCGGCCTGCACGTACACCGGAACAGCGCTCACAGTGCTGGGGTGGGCGCCATC
TTTGACAGGGTGCTAACAGAGCTGGTGTCTAAGATGCGTGACATGCAGATGGACAAGACGGAGCTGGGCT
GCCTGCGAGCCATTGTCCTGTTCAACCCTGACTCTAAGGGGCTCTCAAACCCTGCTGAGGTGGAGGCGTT
GAGGGAGAAGGTGTATGCGTCACTAGAAGCGTACTGCAAACACAAGTACCCTGAGCAGCCGGGCAGGTTT
GCCAAGCTGCTGCTCCGCCTGCCTGCACTGCGTTCCATCGGGCTCAAGTGCCTGGAGCACCTGTTCTTCT
TCAAGCTCATCGGGGACACGCCCATCGACACCTTCCTCATGGAGATGCTGGAGGCACCACATCAAGCCAC
CTAG


Restriction Sites SgfI-MluI     
ACCN NM_011305
Insert Size 1404 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC138800, AAI38801
RefSeq Size 3216 bp
RefSeq ORF 1404 bp
Locus ID 20181
UniProt ID P28700
Cytogenetics 2 19.38 cM
Gene Summary Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.