Rorb (NM_001043354) Mouse Untagged Clone

CAT#: MC216192

Rorb (untagged) - Mouse RAR-related orphan receptor beta (Rorb), transcript variant 1, (10ug)


  "NM_001043354" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rorb Antibody - N-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rorb"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rorb
Synonyms hstp; Nr1f2; Rorbeta; RZR-beta; RZRB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216192 representing NM_001043354
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGAGCACAAATTGAAGTGATACCATGCAAAATTTGTGGCGATAAATCCTCCGGGATCCACTACGGAG
TCATCACGTGTGAAGGCTGCAAGGGATTCTTCAGGAGGAGCCAGCAGAACAATGCCTCTTACTCCTGCCC
AAGGCAGAGAAACTGTTTAATTGACAGAACCAACAGGAACCGTTGCCAACACTGCCGCCTGCAGAAGTGT
CTTGCCCTAGGAATGTCAAGAGATGCTGTAAAGTTCGGGAGGATGTCCAAGAAGCAGCGGGACAGCCTGT
ATGCTGAGGTGCAGAAGCATCAGCAAAGGCTGCAGGAGCAGCGGCAGCAGCAGAGTGGGGAGGCGGAGGC
CCTCGCCAGGGTGTACAGCAGCAGCATTAGCAATGGCCTCAGCAACCTGAACACCGAGACCGGCGGCACA
TACGCCAACGGGCACGTCATTGACCTGCCCAAGTCCGAAGGTTATTACAGCATAGATTCCGGTCAGCCGT
CTCCCGATCAGTCAGGACTGGACATGACTGGGATCAAACAGATAAAGCAAGAACCTATCTATGACCTCAC
ATCTGTACCCAACTTGTTTACCTATAGCTCTTTCAACAACGGGCAGTTAGCTCCCGGGATAACAATGTCT
GAGATCGATCGAATTGCACAGAACATCATTAAGTCCCATTTGGAGACATGTCAGTACACCATGGAAGAAC
TCCATCAGCTGGCATGGCAGACCCACACCTACGAGGAAATCAAGGCGTATCAAAGCAAGTCCAGGGAGGC
TCTGTGGCAGCAGTGTGCCATCCAGATCACCCATGCTATCCAGTACGTGGTGGAGTTCGCCAAGCGGATA
ACAGGCTTCATGGAGCTGTGTCAGAACGATCAGATCTTACTTCTGAAGTCAGGTTGCTTGGAAGTGGTTT
TAGTGAGAATGTGTCGTGCCTTCAACCCATTAAACAACACTGTTCTGTTTGAAGGAAAATATGGAGGAAT
GCAAATGTTCAAAGCCTTAGGTTCGGATGACCTAGTGAATGAAGCATTTGACTTTGCGAAGAATCTGTGT
TCCTTGCAGCTGACTGAGGAAGAGATTGCTCTGTTCTCCTCTGCTGTTCTGATATCCCCAGACCGAGCCT
GGCTGATCGAACCAAGAAAAGTCCAGAAGCTTCAGGAAAAGATTTATTTTGCACTGCAACATGTGATTCA
GAAGAACCACCTGGATGATGAGACCCTGGCAAAGTTAATAGCCAAGATACCAACTATCACGGCAGTCTGC
AACTTGCATGGGGAGAAGCTGCAGGTATTTAAGCAGTCTCATCCAGACATAGTGAATACACTGTTTCCTC
CATTGTACAAGGAGCTCTTTAATCCTGACTGTGCTGCGGTCTGCAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001043354
Insert Size 1380 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001043354.2, NP_001036819.1
RefSeq Size 9289 bp
RefSeq ORF 1380 bp
Locus ID 225998
UniProt ID Q8R1B8
Cytogenetics 19 B
Gene Summary The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (1) has an alternate exon in place of the first exon compared to variant 2. The resulting isoform (1) has a shorter and distinct N-terminus compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.