Dapk3 (NM_007828) Mouse Untagged Clone

CAT#: MC215925

Dapk3 (untagged) - Mouse death-associated protein kinase 3 (Dapk3), transcript variant 2, (10ug)


  "NM_007828" in other vectors (4)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Dapk3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dapk3
Synonyms dlk; ZIPK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215925 representing NM_007828
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCACATTCAGGCAAGAGGATGTTGAGGACCATTATGAGATGGGAGAGGAGCTTGGCAGTGGCCAAT
TTGCCATCGTGCGCAAGTGCCAGCAGAAGGGCACGGGCATGGAGTATGCAGCCAAGTTCATCAAGAAGCG
GCGCCTGCCATCCAGCCGGCGCGGTGTGAGCCGGGAGGAGATCGAACGCGAGGTGAGCATCCTGCGCGAG
ATCCGCCACCCCAACATCATAACACTGCATGACGTGTTCGAGAACAAGACAGATGTGGTGCTGATCCTGG
AGCTGGTGTCCGGTGGCGAGCTTTTCGACTTCCTGGCCGAGAAGGAGTCATTGACGGAGGATGAGGCCAC
GCAGTTCCTCAAACAAATCCTAGACGGTGTCCACTACCTGCACTCCAAGCGCATCGCACACTTTGACCTG
AAGCCCGAGAACATCATGTTGCTGGACAAGCACGCAGCCAGCCCCCGCATTAAGCTCATCGACTTTGGCA
TCGCGCACAGGATCGAGGCTGGCAGCGAGTTCAAGAACATCTTTGGCACACCCGAGTTTGTCGCCCCCGA
GATCGTGAACTATGAGCCACTTGGCTTGGAGGCTGACATGTGGAGCATTGGCGTCATCACCTACATCCTC
CTGAGCGGAGCGTCCCCATTCCTGGGCGAGACCAAGCAGGAGACGCTGACGAACATCTCAGCAGTGAACT
ATGACTTTGATGAGGAATACTTCAGCAGCACCAGCGAGCTGGCCAAGGACTTCATCCGCAGGCTGCTGGT
CAAAGACCCCAAGAGGAGGATGACCATCGCACAGAGCCTGGAGCATTCCTGGATCAAGGTGCGCAGGCGC
GAGGACGGCGCCCGGAAGCCAGAGCGACGGCGGCTGCGCGCCGCGCGCCTGCGCGAGTACAGCCTCAAGT
CCCACTCGAGCATGCCGCGCAACACGAGCTACGCCAGCTTCGAGCGCTTCTCACGCGTGCTGGAGGACGT
GGCGGCGGCAGAGCAGGGGCTGCGCGAGCTGCAGCGAGGCAGGCGCCAGTGCCGGGAGCGCGTGTGTGCG
CTGCGCGCGGCCGCCGAGCAGCGGGAGGCGCGCTGCCGCGACGGGAGCGCAGGGCTAGGGCGCGACCTGC
GACGCCTGCGCACGGAGCTGGGGCGCACCGAGGCTCTGCGCACGCGCGCGCAGGAGGAGGCGCGGGCGGC
GCTGTTGGGTGCCGGGGGCCTGAAGCGTCGCCTGTGTCGCCTGGAGAACCGTTACGACGCGCTAGCCGCT
CAGGTGGCCGCTGAGGTGCAATTCGTGCGCGACCTGGTGCGTGCGCTGGAGCAGGAACGGCTGCAGGCTG
AGTGCGGCGTGCGCTAG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_007828
Insert Size 1347 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007828.2, NP_031854.1
RefSeq Size 1696 bp
RefSeq ORF 1347 bp
Locus ID 13144
UniProt ID O54784
Cytogenetics 10 39.72 cM
Gene Summary Serine/threonine kinase which is involved in the regulation of apoptosis, autophagy, transcription, translation and actin cytoskeleton reorganization. Regulates both type I (caspase-dependent) apoptotic and type II (caspase-independent) autophagic cell deaths signal, depending on the cellular setting. Involved in formation of promyelocytic leukemia protein nuclear body (PML-NB). Involved in apoptosis involving PAWR which mediates cytoplasmic relocation; in vitro phosphorylates PAWR (By similarity). Phosphorylates MYL12B in non-muscle cells leading to reorganization of actin cytoskeleton such as in regulation of cell polarity and cell migration. Positively regulates canonical Wnt/beta-catenin signaling through interaction with NLK and TCF7L2; disrupts the NLK-TCF7L2 complex thereby influencing the phosphorylation of TCF7L2 by NLK. Phosphorylates STAT3 and enhances its transcriptional activity. Enhances transcription from AR-responsive promoters in a hormone- and kinase-dependent manner. Phosphorylates histone H3 on 'Thr-11' at centromeres during mitosis (By similarity). Phosphorylates RPL13A on 'Ser-77' upon interferon-gamma activation which is causing RPL13A release from the ribosome, RPL13A association with the GAIT complex and its subsequent involvement in transcript-selective translation inhibition.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). Sequence Note: This RefSeq record was created from genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.