Col26a1 (NM_024474) Mouse Untagged Clone

CAT#: MC215864

Col26a1 (untagged) - Mouse EMI domain containing 2 (Emid2), (10ug)

USD 567.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Col26a1 (NM_024474) Mouse Untagged Clone
Symbol Col26a1
Synonyms 9430032K24Rik; BC002218; Col26a; Emid2; Emu2
Vector pCMV6-Entry
Sequence Data
>MC215864 representing NM_024474
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCTGGTTTTGCTGTTACCATGGGCGTGCTGCTGCTTGTGCGGGTCGGCGCTGGCCACCGGCTTTC
TCTACCCGTTCCCGGCAGCAGCCTTGCAGCAGCACGGCTACCCGGAGCAGGGCGCCGGCTCCCCCGGCAA
CGGCTACTCGAGTCGCCGGCACTGGTGCCATCACACGGTGACAAGGACAGTGTCCTGCCAGGTGCAGAAT
GGCTCCGAGACGGTGGTCCAGCGAGTCTACCAGAGCTGCCGGTGGCCTGGGCCCTGTGCCAACCTCGTGA
GTTACAGGACTCTCATTAGACCGACCTACCGGGTTTCCTACCGCACGGTGACTGCGCTGGAGTGGAGGTG
TTGCCCAGGATTCACCGGAAGCAACTGCGAGGAAGAATGTATGAACTGTACCCGGCTTAGCGACATGAGT
GAACGGCTGACCACGCTGGAGGCCAAGGTCCTCTTGCTGGAAGCAGCTGAGCAGCCTTCAGGTCCAGACA
ATGACCTGCCACCCCCGCAGAGCACCCCACCAACCTGGAACGAGGACTTCCTGCCAGACGCCATTCCCAT
CGCACATCCAGGGCCCCGGAGGAGAAGACCCACAGGTCCAGCTGGACCTCCAGGACAGATGGGACCACCT
GGACCTGCAGGACCTCCAGGTTCCAAAGGTGAACAGGGCCAGACAGGAGAGAAGGGCCCAGTGGGACCTC
CAGGTCTCTTGGGACCACCGGGGCCACGCGGGCTCCCTGGAGAGATGGGGCGCCCTGGTCCACCAGGCCC
TCCTGGCCCAGCAGGAAGTCCTGGCCTCTTGCCAAACACTCCCCAAGGCGTCCTGTATTCCCTGCAGACA
CCAACAGACAAGGAGAATGGAGACTCCCAGCTGAACCCTGCTGTTGTAGACACAGTGCTGACTGGCATCC
CAGGTCCCCGGGGTCCCCCAGGCCCCCCTGGTCCCCCAGGACCACACGGCCCCCCAGGACCCCCAGGAGC
ACCTGGATCCCAGGGCCTGGTGGATGAGCGGGTTGTGGCAAGGCCATCTGGTGAGCCCAGTGTGAAGGAA
GAAGAGGACAAAGCCAGCGCTGCAGAGGGAGAAGGTGTGCAGCAGCTTCGCGAGGCCCTGAAGATCCTGG
CAGAGAGGGTCCTTATCCTTGAGCATATGATTGGAGTCCATGATCCCCTGGCCTCTCCTGAGGGTGGCTC
TGGGCAGGATGCAGCCCTGAGAGCCAATCTCAAGATGAAGCGAGGAGGTCCTCGACCTGACGGCATCCTG
GCTGCCCTGCTGGGCCCCGACCCTGCACAAAAGAGCGCAGACCAGGCTGGCGACAGGAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_024474
ORF Size 1323 bp
Insert Size 1323
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_024474.2, NP_077794
RefSeq Size 2705
RefSeq ORF 1323
Locus ID 140709
Cytogenetics 5|5 G2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.