Tead3 (NM_011566) Mouse Untagged Clone

CAT#: MC215811

Tead3 (untagged) - Mouse TEA domain family member 3 (Tead3), transcript variant 2, (10ug)


  "NM_011566" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tead3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tead3
Synonyms DTEF-1; ETFR-; ETFR-1; Tcf13r; Tcf13r2; TEAD-; TEAD-3; TEF-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215811 representing NM_011566
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATAGCGTCCAACAGCTGGACCGCCAACAGCAGCCCCGGGGAGGCCCGGGAAGATGGGTCCGAAGGCCTGG
ACAAGGGTCTGGACAACGATGCGGAGGGAGTGTGGAGCCCGGACATCGAGCAGAGCTTTCAGGAGGCCCT
GGCCATCTACCCGCCTTGCGGACGGCGCAAGATCATCCTGTCAGATGAGGGCAAGATGTACGGTCGAAAT
GAGCTGATTGCCCGCTACATCAAGCTGAGGACTGGAAAAACCAGGACAAGAAAACAGGTGTCCAGCCACA
TACAGGTTCTAGCTCGGAAGAAGGTTCGGGAATACCAGGTTGGCATTAAGGCTATGAACCTGGACCAAGT
CTCCAAGGACAAAGCTCTCCAGAGCATGGCATCCATGTCGTCTGCCCAAATCGTCTCTGCCAGCGTTCTA
CAGAACAAGTTCAGCCCGCCCTCCCCTCTACCCCAGGCTGTCTTCTCCTCCTCCTCAAGGTTCTGGAGCA
GCCCCCCTCTGCTAGGACAACAGCCTGGACCTTCTCAGGACATCAAGCCCTTTGCCCAGCCTGCCTACCC
CATCCAGCCTCCCTTGCCACCAGCGCTCAACAGTTATGAGTCCCTCGCCCCGCTGCCCCCAGCCGCTGCC
TCAGCCACCGCCTCTGCGCCTGCATGGCAGGACCGCACCATCGCCTCCTCCCGGCTACGCCTCCTGGAGT
ATTCTGCCTTCATGGAGGTGCAACGGGACCCTGACACGTACAGCAAACACCTGTTTGTACACATCGGCCA
GACAAACCCTGCCTTCTCAGACCCACCCCTGGAGGCAGTGGATGTACGACAGATCTACGACAAGTTCCCC
GAGAAGAAGGGGGGGCTGAAGGAACTCTACGAGAAGGGGCCCCCGAACGCTTTCTTCCTTGTCAAGTTCT
GGGCTGACCTCAACAGCACAATCCAGGAAGGCCCTGGGGCCTTCTACGGGGTCAGCTCGCAGTACAGCTC
AGCCGACAGCATGACCATCAGCGTCTCCACCAAGGTCTGCTCCTTCGGCAAGCAGGTGGTAGAGAAGGTG
GAGACCGAGTACGCCCGCCTGGAGAACGGCCGCTTCGTGTACCGCATCCACCGCTCACCCATGTGCGAGT
ACATGATCAATTTCATCCACAAACTGAAGCATCTGCCCGAGAAGTACATGATGAACAGTGTGCTGGAGAA
CTTCACCATCCTGCAGGTGGTCACAAGTCGGGACTCGCAGGAGACCCTGCTGGTCATTGCTTTTGTCTTT
GAAGTCTCCACCAGCGAGCATGGGGCGCAGCACCACGTCTACAAGCTTGTCAAAGACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011566
Insert Size 1320 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011566.4, NP_035696.3
RefSeq Size 2616 bp
RefSeq ORF 1320 bp
Locus ID 21678
UniProt ID P70210
Cytogenetics 17 14.66 cM
Gene Summary This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is predominantly expressed in the placenta and thought to play a role in placental gene regulation and development. Alternative splicing, and alternate use of an upstream AUG translation initiation codon, and an in-frame downstream non-AUG (AUA) codon, results in 2 isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has a different 5' terminal exon and initiates translation from an in-frame, downstream, non-AUG (AUA) start site, compared to variant 1. Variants 2 and 3 encode the same isoform (2), which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.