Xlr5b (NM_001111293) Mouse Untagged Clone

CAT#: MC215260

Xlr5b (untagged) - Mouse X-linked lymphocyte-regulated 5B (Xlr5b), (10ug)

  View "NM_001111293" in other vectors (6)

USD 410.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Xlr5b (NM_001111293) Mouse Untagged Clone
Symbol Xlr5b
Synonyms OTTMUSG00000017646
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC215260 representing NM_001111293
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCAAACAAGGAACAAAAGGCCATGAAGAAAAGTGGCAAGCACCAGAGGGTACATAAGACCCTCCCAT
CAGATGACTTCAAGAACTCAGATGAAGTTAACCCTGCTGACAAACCAGCAGTTGGTACCAGTGGGATGGG
CAGCCATTCTTCAGGATCAGACATGCAAGAGGCCAGGGAGCCTGTTCAGAAGAAGATGCAGGATTTCAAA
GGTGATGATGGTACAGGACTTCTTATGGAAAAGAGGAAACAGTTTGAAGAGGATGTAAATGCCTCTTTCA
GAAGTCTGAATGAAAACCTCCAGAGCATTTTGAAAGCTCAGCAGAATTCAAGGCAGGAGCTTAAGTCTCT
GTACTGTGAAAGATTTGGGTCGGTGTACCACAATTGGCTGGTTGAGATGGACAGAACAAGGGACCAAGAA
GAATACTTCAGTTTTATAACCCAGCAGCAAATGAAGATTTTACAGACGGCTATAGAGGACCATGAAACCA
AGCTCAAAAACGCTAAAGATATGTGTGACACATTTTTGAAGAAAGCCAACGACTTGAGTAAACGTCAAAA
AACCTTTATTGGTGGTCAGCAGACTATTGTGGAGAAGGAAATCTCCAAGGTGCAGAACAGAGTAATCATG
GAAACCCAAGATCAAGACATAGCCATGGTTGAAACATACCTTCAGTCCCTGATCCATGAAAGCTCTGAAG
AAACCATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001111293
ORF Size 711 bp
Insert Size 711
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001111293.1, NP_001104763
RefSeq Size 1134
RefSeq ORF 711
Locus ID 627081
Cytogenetics X A7.3|X

Other Versions

Other products for "Xlr5b"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones