Lin28b (NM_001031772) Mouse Untagged Clone

CAT#: MC214667

Lin28b (untagged) - Mouse lin-28 homolog B (C. elegans) (Lin28b), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Lin28b
• Synonyms: 2810403D23Rik; D030047M17Rik; Lin-28.2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214667 representing NM_001031772
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGAAGGCGGGGCAAGCAAAGGTGAAGAGCCAGAAAAACTGCCCGGGCTGGCAGAGGACGAACCCC
  AGGTTCTGCATGGCACTGGCCACTGTAAATGGTTCAACGTGCGCATGGGATTCGGATTCATCTCCATGAT
  AAGTCGAGAGGGAAATCCCTTGGATATTCCAGTGGATGTATTTGTACACCAAAGCAAACTATTCATGGAA
  GGATTTAGAAGCTTGAAAGAAGGAGAGCCAGTGGAATTTACATTTAAAAAATCCCCCAAAGGCCTTGAGT
  CAATACGGGTAACAGGCCCAGGTGGGAGCCCCTGCTTAGGAAGTGAAAGAAGACCTAAAGGGAAGACCCT
  GCAAAAGAGAAAGCCAAAGGGAGATAGGTGGAGACGGCAGGATTTACTGATGGATCAGATGTGGACTGTG
  CGAGAAGAAGAGTCCAGGATGATTCCAAGATGCTACAACTGTGGTGGTCTCGACCATCATGCTAAAGAAT
  GCAGTCTACCTCCTCAGCCAAAGAAGTGCCATTACTGTCAGAGCATCATGCACATGGTGGCCAACTGCCC
  ACACAAGCTTGCCGCTCAGCTGCCCGCCAGTTCTCAGGGAAGACAGGAGGCAGAATCCCAGCCATGCAGC
  TCTGCGGCACCAAGAGAAGTGGGAGGGGGGCATGGCTGCACAGTACTGTTTCCTCAGGAGGTGAAGTCAG
  AAATGGCAGAGCACTCAGACAGGTCACCCCAAGAAGTTTCTTCCACGAAAGCGTTTGCAGCAATAGGAGA
  GCAAAACAAAAAGGGGCCTTTGATTCAGAAACGGAAAAAGACTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001031772
• Insert Size: 816 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC089037, AAH89037
• RefSeq Size: 5411 bp
• RefSeq ORF: 816 bp
• Locus ID: 380669
• UniProt ID: Q45KJ6
• Cytogenetics: 10 B2
• Gene Summary: Suppressor of microRNA (miRNA) biogenesis, including that of let-7 and possibly of miR107, miR-143 and miR-200c. Binds primary let-7 transcripts (pri-let-7), including pri-let-7g and pri-let-7a-1, and sequester them in the nucleolus, away from the microprocessor complex, hence preventing their processing into mature miRNA. Does not act on pri-miR21. The repression of let-7 expression is required for normal development and contributes to maintain the pluripotent state of embryonic stem cells by preventing let-7-mediated differentiation. When overexpressed, recruits ZCCHC11/TUT4 uridylyltransferase to pre-let-7 transcripts, leading to their terminal uridylation and degradation. This activity might not be relevant in vivo, as LIN28B-mediated inhibition of let-7 miRNA maturation appears to be ZCCHC11-independent. Interaction with target pre-miRNAs occurs via an 5'-GGAG-3' motif in the pre-miRNA terminal loop (By similarity). Mediates MYC-induced let-7 repression (PubMed:19211792). When overexpressed, may stimulate growth of carcinoma cell lines (By similarity).[UniProtKB/Swiss-Prot Function]