Serf2 (NM_011354) Mouse Untagged Clone
CAT#: MC214665
Serf2 (untagged) - Mouse small EDRK-rich factor 2 (Serf2), (10ug)
"NM_011354" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Serf2 |
Synonyms | C80083; m4F5rel; Msmac1l |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214665 representing NM_011354
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCCGCGGTAACCAGCGAGAGCTCGCCCGCCAGAAGAACATGAAGAAGCAGAGCGACTCGGTTAAGG GAAAGCGCCGAGATGATGGGCTTTCTGCTGCCGCCCGCAAGCAGAGGGACTCGGAGATCATGCAGCAGAA GCAGAAAAAGGCAAACGAGAAGAAGGAGGAACCCAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011354 |
Insert Size | 180 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_011354.3, NP_035484.1 |
RefSeq Size | 3072 bp |
RefSeq ORF | 180 bp |
Locus ID | 378702 |
UniProt ID | P84102 |
Cytogenetics | 2 E5 |
Gene Summary | Positive regulator of amyloid protein aggregation and proteotoxicity (By similarity). Induces conformational changes in amyloid proteins, such as HTT, driving them into compact formations preceding the formation of aggregates (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site in the 3' terminal exon, which results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220477 | Serf2 (tGFP-tagged) - Mouse small EDRK-rich factor 2 (Serf2), (10ug) |
USD 350.00 |
|
MR220477 | Serf2 (Myc-DDK-tagged) - Mouse small EDRK-rich factor 2 (Serf2) |
USD 150.00 |
|
MR220477L3 | Lenti ORF clone of Serf2 (Myc-DDK-tagged) - Mouse small EDRK-rich factor 2 (Serf2) |
USD 450.00 |
|
MR220477L4 | Lenti ORF clone of Serf2 (mGFP-tagged) - Mouse small EDRK-rich factor 2 (Serf2) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review