Serf2 (NM_011354) Mouse Untagged Clone

CAT#: MC214665

Serf2 (untagged) - Mouse small EDRK-rich factor 2 (Serf2), (10ug)


  "NM_011354" in other vectors (4)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Serf2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Serf2
Synonyms C80083; m4F5rel; Msmac1l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214665 representing NM_011354
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCCGCGGTAACCAGCGAGAGCTCGCCCGCCAGAAGAACATGAAGAAGCAGAGCGACTCGGTTAAGG
GAAAGCGCCGAGATGATGGGCTTTCTGCTGCCGCCCGCAAGCAGAGGGACTCGGAGATCATGCAGCAGAA
GCAGAAAAAGGCAAACGAGAAGAAGGAGGAACCCAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011354
Insert Size 180 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011354.3, NP_035484.1
RefSeq Size 3072 bp
RefSeq ORF 180 bp
Locus ID 378702
UniProt ID P84102
Cytogenetics 2 E5
Gene Summary Positive regulator of amyloid protein aggregation and proteotoxicity (By similarity). Induces conformational changes in amyloid proteins, such as HTT, driving them into compact formations preceding the formation of aggregates (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' terminal exon, which results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.