Snapc5 (NM_183316) Mouse Untagged Clone
CAT#: MC214597
Snapc5 (untagged) - Mouse small nuclear RNA activating complex, polypeptide 5 (Snapc5), (10ug)
"NM_183316" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Snapc5 |
Synonyms | 2010103A03Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214597 representing NM_183316
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTGAGTCGACTGCAGGAGCTCCGCAAGGAGGAGGAAACCCTGCTGCGTCTAAAGGCGGCTCTACACG ACCAACTGAACCGCCTCAAGGTTGAAGAATTAGCCCTTCAATCCATGATAAATTCTCGAGGAAGGACCGA GACACTGTCTTCTCAGCCTGCACCTGAACAGTTATGTGATATGTCCCTACATGTAGACAACGAAGTGACA ATAAATCAGACTACACTGAAGCTGAGCACAAGGAGCCCTATGGAAGAAGAGGAGGAGGAAGAGGAGGAGG AAGAGGAGGAGGAAGAATCTGATTCGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_183316 |
Insert Size | 309 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_183316.2, NP_899139.2 |
RefSeq Size | 781 bp |
RefSeq ORF | 309 bp |
Locus ID | 330959 |
UniProt ID | Q8R2K7 |
Cytogenetics | 9 C |
Gene Summary | Part of the SNAPc complex required for the transcription of both RNA polymerase II and III small-nuclear RNA genes. Binds to the proximal sequence element (PSE), a non-TATA-box basal promoter element common to these 2 types of genes. Recruits TBP and BRF2 to the U6 snRNA TATA box (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217707 | Snapc5 (tGFP-tagged) - Mouse small nuclear RNA activating complex polypeptide 5 (Snapc5), (10ug) |
USD 365.00 |
|
MR217707 | Snapc5 (Myc-DDK-tagged) - Mouse small nuclear RNA activating complex, polypeptide 5 (Snapc5) |
USD 165.00 |
|
MR217707L3 | Lenti ORF clone of Snapc5 (Myc-DDK-tagged) - Mouse small nuclear RNA activating complex, polypeptide 5 (Snapc5) |
USD 465.00 |
|
MR217707L4 | Lenti ORF clone of Snapc5 (mGFP-tagged) - Mouse small nuclear RNA activating complex, polypeptide 5 (Snapc5) |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review