Birc7 (NM_001163247) Mouse Untagged Clone

CAT#: MC214562

Birc7 (untagged) - Mouse baculoviral IAP repeat-containing 7 (livin) (Birc7), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Birc7
• Synonyms: E130019N06; KIAP; Livin; ML-IAP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214562 representing NM_001163247
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTCTCACCTGCAGACTTATTCAGAGCTGCTGTCTTTTCCATGGGGCCTGAGAGTAGGGCCAGGGACT
  CGGTCCGTGGCCCAGAACTAAGCCACAGGGAAGATGGCAGTGGCCGCACACAGGAACAGGATAAACCCCA
  CTGTCCGTGTAACCATGTCCTGGGCCAGGACTGCCTAGATGGGCAGATCTTAGGCCAGCTTCGGCCTCTG
  TCAGAAGAGGAAGAATCCTCTGGGGCTGCCTTCCTTGGGGAGCCTGCCTTCCCTGAGATGGACTCAGAGG
  ATCTCCGGCTAGCCTCCTTCTACGACTGGCCATCTACTGCAGGGATTCAGCCTGAGCCATTGGCTGCTGC
  TGGGTTCTTCCACACAGGCCAGCAGGACAAGGTGAGATGTTTCTTCTGCTATGGGGGTCTACAGAGCTGG
  GAGCGTGGGGATGACCCCTGGACAGAGCATGCCCGATGGTTTCCCAGGTGTCAGTTCCTGCTACGGTCAA
  AAGGAAGGGACTTTGTGGAAAGAATCCAGACCTACACCCCTTTGCTGGGATCCTGGGATCAGCGAGAAGA
  ACCAGAAGATGCAGTCTCTGCCACTCCCTCAGCTCCTGCCCATGGAAGCCCTGAGTTACTCAGATCCAGA
  AGAGAGACCCAGCCTGAAGATGTCAGTGAGCCAGGAGCCAAGGATGTTCAGGAACAGCTGCGACAGCTGC
  AGGAAGAGAGGAGATGCAAGGTGTGCCTGGACCGAGCCGTCTCCATAGTCTTCGTGCCCTGTGGCCACTT
  CGTCTGCACCGAGTGTGCTCCCAACCTGCAGCTGTGCCCTATCTGCAGGGTGCCTATCTGTAGCTGTGTA
  CGCACATTCCTGTCCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001163247
• Insert Size: 858 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001163247.1, NP_001156719.1
• RefSeq Size: 1178 bp
• RefSeq ORF: 858 bp
• Locus ID: 329581
• UniProt ID: A2AWP0
• Cytogenetics: 2 H4
• Gene Summary: Apoptotic regulator capable of exerting proapoptotic and anti-apoptotic activities and plays crucial roles in apoptosis, cell proliferation, and cell cycle control. Its anti-apoptotic activity is mediated through the inhibition of caspase-3, -7, and -9, as well as by its E3 ubiquitin-protein ligase activity. As it is a weak caspase inhibitor, its anti-apoptotic activity is thought to be due to its ability to ubiquitinate DIABLO/SMAC targeting it for degradation thereby promoting cell survival. May contribute to caspase inhibition, by blocking the ability of DIABLO/SMAC to disrupt XIAP/BIRC4-caspase interactions. Protects against apoptosis induced by TNF or by chemical agents such as adriamycin, etoposide or staurosporine. Suppression of apoptosis is mediated by activation of MAPK8/JNK1, and possibly also of MAPK9/JNK2. This activation depends on TAB1 and NR2C2/TAK1.[UniProtKB/Swiss-Prot Function]