H2bc6 (NM_001177653) Mouse Untagged Clone
CAT#: MC214386
Hist1h2be (untagged) - Mouse histone cluster 1, H2be (Hist1h2be), transcript variant 1, (10ug)
"NM_001177653" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | H2bc6 |
Synonyms | Gm11398; H2bc4; H2bc8; Hist1h2; Hist1h2be |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214386 representing NM_001177653
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTGAGCCAGCCAAGTCCGCTCCCGCCCCGAAGAAGGGCTCCAAGAAGGCTGTCACCAAGGCCCAGA AGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCGGTGTACGTGTACAAGGTGCTGAA GCAAGTGCACCCCGACACCGGCATCTCCTCCAAGGCCATGGGCATCATGAACTCGTTCGTGAACGACATC TTCGAGCGCATCGCGGGCGAGGCGTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACATCCCGGG AGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGCTGGCCAAGCACGCGGTGTCGGAGGGCACCAA GGCTGTCACCAAGTACACCAGCTCCAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001177653 |
Insert Size | 381 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001177653.1, NP_001171124.1 |
RefSeq Size | 2483 bp |
RefSeq ORF | 381 bp |
Locus ID | 319179 |
UniProt ID | Q6ZWY9 |
Cytogenetics | 13 A3.1 |
Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family and generates multiple transcripts through alternative splicing, the use of the conserved stem-loop termination motif, and the polyA addition motif. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (1) and variants 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG219719 | Hist1h2be (tGFP-tagged) - Mouse histone cluster 1 H2be (Hist1h2be) transcript variant 1, (10ug) |
USD 350.00 |
|
MR219719 | Hist1h2be (Myc-DDK-tagged) - Mouse histone cluster 1, H2be (Hist1h2be), transcript variant 1 |
USD 150.00 |
|
MR219719L3 | Lenti ORF clone of Hist1h2be (Myc-DDK-tagged) - Mouse histone cluster 1, H2be (Hist1h2be), transcript variant 1 |
USD 450.00 |
|
MR219719L4 | Lenti ORF clone of Hist1h2be (mGFP-tagged) - Mouse histone cluster 1, H2be (Hist1h2be), transcript variant 1 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review