Il17f (NM_145856) Mouse Untagged Clone
CAT#: MC213271
Il17f (untagged) - Mouse interleukin 17F (Il17f), (10ug)
"NM_145856" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Il17f |
Synonyms | C87042; IL-17F |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC213271 representing NM_145856
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_145856 |
Insert Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145856.2, NP_665855.2 |
RefSeq Size | 1178 bp |
RefSeq ORF | 486 bp |
Locus ID | 257630 |
UniProt ID | Q7TNI7 |
Cytogenetics | 1 A4 |
Gene Summary | Ligand for IL17RA and IL17RC (PubMed:17911633). The heterodimer formed by IL17A and IL17F is a ligand for the heterodimeric complex formed by IL17RA and IL17RC (By similarity). Involved in stimulating the production of other cytokines such as IL6, IL8 and CSF2, and in regulation of cartilage matrix turnover. Also involved in stimulating the proliferation of peripheral blood mononuclear cells and T-cells and in inhibition of angiogenesis (By similarity). Plays a role in the induction of neutrophilia in the lungs and in the exacerbation of antigen-induced pulmonary allergic inflammation (PubMed:15477493).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225847 | Il17f (tGFP-tagged) - Mouse interleukin 17F (Il17f), (10ug) |
USD 350.00 |
|
MR225847 | Il17f (Myc-DDK-tagged) - Mouse interleukin 17F (Il17f) |
USD 150.00 |
|
MR225847L3 | Lenti ORF clone of Il17f (Myc-DDK-tagged) - Mouse interleukin 17F (Il17f) |
USD 450.00 |
|
MR225847L4 | Lenti ORF clone of Il17f (mGFP-tagged) - Mouse interleukin 17F (Il17f) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review