Ankrd27 (NM_178263) Mouse Untagged Clone

CAT#: MC213234

Ankrd27 (untagged) - Mouse ankyrin repeat domain 27 (VPS9 domain) (Ankrd27), transcript variant 2, (10ug)


  "NM_178263" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ankrd27"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ankrd27
Synonyms AA408090; BC016493; D330003H11Rik; Varp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC213234 representing NM_178263
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCTATATGATGAAGATCTCCTGAAAAACCCTTTCTACCTGGCCCTTCAGAAGTGGCGCCCCGACT
TGTGCAGCAAGGTGGCCCAGATCCATGGCATTGTCCTAGTGCCTTGCAGAGGAAGCCTGCCCGGCAGTGT
GCAGGCCTCCTGCCAGTTCGAGTCCTATGTTTTGGTACCCACGGAAGGACACTTTCAGACCTTAGATGGA
AAGGCTGTCGTCATTGAAGGAAACAGGATTAAGCTAGGAGCAGGTTTTGCTTGCCTTCTCTCTGTGCCCA
TCCTCTTTGAGGAGACTTTCTACAACGAGAAAGAGGAGAGTTTCAGCATTCTCTGCATTGCTCATCCTTT
GGAGAGGAGAGAGACTTCAGAAGAACCTTCAGCGCCTGCAGATCCTTTCTCCCTGAAAACCATCGAAGAT
GTGAGAGAATTTTTGGGAAGACACTCAGAGAAATTTGACAAGAACATTGCCTCTTTCCACCGGACGTTCC
GAGAATGTGAAAGAAAGAGCCTCCGCCACCACATAGACTCCGTAAATGCTCTCTACACCAAATGCCTCCA
GCAGCTTCTCCGAGACTCTCACCTGAAGGTTCTTGCAAAGCAGGAGGCCCAGATGAACCTGATGAAGCAG
GCCGTAGAGATGTATGTCCATCACGATATTTACGACCTGATCTTTAAATACGTGGGGACCATGGAGGCGA
GCGAGGATGCCGCCTTTAACAAAATCACGAGAAGCCTTCAAGATCTCCAGCAGAAAGACATCGGCGTGAA
ACCCGAGTTCAGCTTCAACATCCCTCGGGCAAAGAGAGAGCTGGGTCAGTTGAACAAGTGTACGTCGCCA
CAGCAGAAGCTGCTGTGCCTGAGGAAGGTGGTCCAGCTCATGACACAATCTCCCAGCCAGAGAGTGAACT
TGGAGACCATGTGTGCCGATGATCTCCTCTCGGTCCTGTTATATCTGCTCGTGAAGACAGAGATCCCTAA
CTGGATGGCAAATTTGAGCTACATCAAAAACTTCAGATTTAGCAGCTCGGCCAAAGATGAGCTAGGATAC
TGCCTGACCTCAGTCGAGGCTGCGATTGAATACATCCGGCAAGGAAGTCTCTCCACGAAGACGCCTGTAA
GGTCTCCCTGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_178263
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_178263.3, NP_839994.1
RefSeq Size 1929 bp
RefSeq ORF 1134 bp
Locus ID 245886
UniProt ID Q3UMR0
Cytogenetics 7 B2
Gene Summary May be a guanine exchange factor (GEF) for Rab21, Rab32 and Rab38 and regulate endosome dynamics (By similarity). May regulate the participation of VAMP7 in membrane fusion events; in vitro inhibits VAMP7-mediated SNARE complex formation by trapping VAMP7 in a closed, fusogenically inactive conformation (By similarity). Involved in peripheral melanosomal distribution of TYRP1 in melanocytes; the function, which probably is implicating vesicle-trafficking, includes cooperation with Rab32, Rab38 and VAMP7 (PubMed:19403694, PubMed:21187289). Involved in the regulation of neurite growth; the function seems to require its GEF activity, probably towards Rab21, and VAMP7 but not Rab32/38 (PubMed:19745841, PubMed:22171327). Proposed to be involved in Golgi sorting of VAMP7 and transport of VAMP7 vesicles to the cell surface; the function seems to implicate kinesin heavy chain isoform 5 proteins, GOLGA4, RAB21 and MACF1. Required for the colocalization of VAMP7 and Rab21, probably on TGN sites (By similarity). Involved in GLUT1 endosome-to-plasma membrane trafficking; the function is dependent of association with VPS29 (By similarity). Regulates the proper trafficking of melanogenic enzymes TYR, TYRP1 and DCT/TYRP2 to melanosomes in melanocytes (PubMed:26620560).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.