Gtf2a2 (NM_001039519) Mouse Untagged Clone
CAT#: MC213008
Gtf2a2 (untagged) - Mouse general transcription factor II A, 2 (Gtf2a2), (10ug)
"NM_001039519" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Gtf2a2 |
Synonyms | TFIIA-gamma; Tfiia2; TfIIg |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC213008 representing NM_001039519
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCTATCAGTTATACAGAAATACAACTTTGGGGAACAGTCTTCAAGAGAGCCTTGATGAGCTCATAC AGTCTCAACAGATCACCCCCCAGCTTGCGCTTCAAGTTCTACTTCAGTTTGATAAAGCTATAAATTCAGC ATTGGCTCAGAGAGTCAGGAACAGAGTCAATTTCAGGGGCTCTCTAAATACATACAGATTCTGCGATAAT GTTTGGACTTTTGTATTGAATGATGTTGAATTCAGAGAGGTGACAGAACTTATTAAAGTGGATAAAGTGA AAATTGTAGCCTGTGATGGTAAAAATACTGGCTCGAATACTACGGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039519 |
Insert Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001039519.2, NP_001034608.1 |
RefSeq Size | 895 bp |
RefSeq ORF | 330 bp |
Locus ID | 235459 |
UniProt ID | Q80ZM7 |
Cytogenetics | 9 D |
Gene Summary | TFIIA is a component of the transcription machinery of RNA polymerase II and plays an important role in transcriptional activation. TFIIA in a complex with TBP mediates transcriptional activity (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217006 | Gtf2a2 (tGFP-tagged) - Mouse general transcription factor II A 2 (Gtf2a2), (10ug) |
USD 365.00 |
|
MR217006 | Gtf2a2 (Myc-DDK-tagged) - Mouse general transcription factor II A, 2 (Gtf2a2) |
USD 165.00 |
|
MR217006L3 | Lenti ORF clone of Gtf2a2 (Myc-DDK-tagged) - Mouse general transcription factor II A, 2 (Gtf2a2) |
USD 465.00 |
|
MR217006L4 | Lenti ORF clone of Gtf2a2 (mGFP-tagged) - Mouse general transcription factor II A, 2 (Gtf2a2) |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review