D14Ertd668e (NM_001164323) Mouse Untagged Clone

CAT#: MC212700

D14Ertd668e (untagged) - Mouse DNA segment, Chr 14, ERATO Doi 668, expressed (D14Ertd668e), transcript variant 1, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name D14Ertd668e (NM_001164323) Mouse Untagged Clone
Symbol D14Ertd668e
Synonyms MGC29273
Vector pCMV6-Entry
Sequence Data
>MC212700 representing NM_001164323
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCAAGAGACAGCACCACCGTGTGGCCCAGTCTCAAGGGGTGACAGTCCAATCATAGAAAAGATGG
AAAAAAGGACATGTGCCCTGTGCCCTGAAGGCCACGAGTGGAGTCAAATATACTTTTCACCATCAGGAAA
TATAGTTGCTCATGAAAACTGTTTGCTGTATTCATCAGGACTGGTGGAGTGTGAGACTCTTGATCTACGT
AATACAATTAGAAACTTTGATGTCAAATCTGTAAAGAAAGAGATCTGGAGAGGAAGAAGATTGAAATGCT
CATTCTGTAACAAAGGAGGCGCCACCGTGGGGTGTGATTTATGGTTCTGTAAGAAGAGTTACCACTATGT
CTGTGCCAAAAAGGACCAAGCAATTCTTCAAGTTGATGGAAACCATGGAACTTACAAATTATTTTGCCCA
GAACATTCTCCAGAACAAGAAGAGGCCACTGAAAGTGCTGATGACCCAAGCATGAAGAAGAAGAGAGGAA
AAAACAAACGCCTCTCATCAGGCCCTCCTGCACAGCCAAAAACGATGAAATGTAGTAACGCCAAAAGACA
TATGACAGAAGAGCCTCATGGTCACACAGATGCAGCTGTCAAATCTCCTTTTCTTAAGAAATGCCAGGAA
GCAGGACTTCTTACTGAACTATTTGAACACATACTAGAAAATATGGATTCAGTTCATGGAAGACTTGTGG
ATGAGACTGCCTCAGAGTCGGACTATGAAGGGATCGAGACCTTACTGTTTGACTGTGGATTATTTAAAGA
CACACTAAGAAAATTCCAAGAAGTAATCAAGAGTAAAGCTTGTGAATGGGAAGAAAGGCAAAGGCAGATG
AAGCAGCAGCTTGAGGCACTTGCAGACTTACAACAAAGCTTGTGCTCATTTCAAGAAAATGGGGACCTGG
ACTGCTCAAGTTCTACATCAGGATCCTTGCTACCTCCTGAGGACCACCAGGTCAGATCCCAGGAGTCTCC
TGAAGTGCAAGCAGGCTCAGGAGACAGCCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001164323
ORF Size 1014 bp
Insert Size 1014
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001164323.1, NP_001157795
RefSeq Size 1531
RefSeq ORF 1014
Locus ID 219132
Cytogenetics 14 C3|14 31.48 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.