Pilrb1 (NM_133209) Mouse Untagged Clone

CAT#: MC212333

Pilrb1 (untagged) - Mouse paired immunoglobin-like type 2 receptor beta 1 (Pilrb1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pilrb1
• Synonyms: Fdact; FDFACT; Pilrb
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212333 representing NM_133209
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTTTGCTGATCTCGCTTCCTGGAGGGACTCCAGCCATGGCTCAGGTCCTGCTTCTGCTCTCATCAG
  GCTGTCTGCATGCTGGAAATTCAGAAAGATACAACAGAAAAAATGGCTTTGGGGTCAACCAACCTGAACG
  CTGCTCTGGAGTCCAGGGTGGCTCCATCGACATCCCCTTCTCCTTCTATTTCCCCTGGAAGTTGGCCAAG
  GATCCACAGATGAGCATAGCCTGGAAATGGAAGGATTTCCATGGGGAAGTCATCTACAACTCCTCCCTGC
  CTTTCATACATGAGCACTTCAAGGGCCGGCTCATCCTGAACTGGACACAGGGTCAGACATCTGGAGTCCT
  CAGAATCCTGAACTTGAAGGAGTCTGACCAAGCCCAGTACTTTAGTCGAGTTAATCTGCAGTCGACAGAA
  GGCATGAAGTTGTGGCAGTCAATTCCTGGAACCCAACTCAACGTGACCCAAGCACTCAACACCACCATGA
  GGAGCCCCTTCATCGTCACCTCTGAATTCACCACAGCTGGCCTGGAGCACACAAGCGACCAGAGGAATCC
  TTCACTGATGAACCTGGGAGCCATGGTCACGATGCTCCTGGCTAAAGTTTTGGTCATAGTCCTAGTCTAT
  GGATGGATGATCTTCCTGAGGTGGAAGCAAAGGCCAGCACACTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_133209
• Insert Size: 675 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_133209.2, NP_573472.2
• RefSeq Size: 1020 bp
• RefSeq ORF: 675 bp
• Locus ID: 170741
• UniProt ID: Q2YFS2
• Cytogenetics: 5 G2
• Gene Summary: Paired receptors consist of highly related activating and inhibitory receptors and are widely involved in the regulation of the immune system. PILRB is thought to act as a cellular signaling activating receptor that associates with ITAM-bearing adapter molecules on the cell surface. Seems to associate with DAP12 and is a receptor for CD99. May be involved in target cell recognition by natural killer cells and in activation of dendritic cells.[UniProtKB/Swiss-Prot Function]