Dnal1 (NM_028821) Mouse Untagged Clone

CAT#: MC212110

Dnal1 (untagged) - Mouse dynein, axonemal, light chain 1 (Dnalc1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dnal1
• Synonyms: 1700010H15Rik; AW121714; Dnalc1; E330027P08Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212110 representing NM_028821
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCAAAAGCAACAACGATCAAAGAAGCCCTGTCCAGATGGGAAGAAAAGACTGGTCAGAAGCCATCTG
  ATGCCAAAGAAATCAAGCTGTATGCCCAGATTCCCCCCATAGAGAAGATGGACGCATCTCTATCCACACT
  TGGTAACTGCGAGAAGCTTTCCCTGTCTACAAACTGCATTGAAAAAATTGCCAACCTGAATGGCCTAAAA
  AACTTGAGGATTTTGTCCTTAGGAAGAAACAACATAAAGAACCTAAATGGACTGGAAGCAGTAGGAGAAA
  CACTGGAAGAACTGTGGATCTCCTACAATTTTATTGAGAAGTTGAAAGGAATCCATGTAATGAAGAAACT
  GAAGATTCTCTACATGTCTAATAACCTGGTAAAAGACTGGGCTGAGTTCCTGAAGCTGGCCGAGCTGCCG
  TGCCTGGAGGACCTGGTGTTCGTCGGTAATCCCCTGGAGGAGAAACACTCTGCCGAGGGCAACTGGATCG
  ATGAAGCAACCAAGAGAGTGCCCAAGCTGAAAAAGCTGGATGGTACTCCAGTAATTAAGGAGGATGAAGA
  AGAGGAAAGCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_028821
• Insert Size: 573 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_028821.3, NP_083097.2
• RefSeq Size: 5792 bp
• RefSeq ORF: 573 bp
• Locus ID: 105000
• UniProt ID: Q05A62
• Cytogenetics: 12 D1
• Gene Summary: Part of the multisubunit axonemal ATPase complexes that generate the force for cilia motility and govern beat frequency (By similarity). Component of the outer arm dynein (ODA). May be involved in a mechanosensory feedback mechanism controlling ODA activity based on external conformational cues by tethering the outer arm dynein heavy chain (DNAH5) to the microtubule within the axoneme (By similarity). Important for ciliary function in the airways and for the function of the cilia that produce the nodal flow essential for the determination of the left-right asymmetry (By similarity).[UniProtKB/Swiss-Prot Function]