Sytl2 (NM_001040087) Mouse Untagged Clone

CAT#: MC211967

Sytl2 (untagged) - Mouse synaptotagmin-like 2 (Sytl2), transcript variant 4, (10ug)


  "NM_001040087" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Sytl2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sytl2
Synonyms AI266830; mKIAA1597; Slp2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211967 representing NM_001040087
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCAAGTCCGTGCCAGCATTTCTTCAAGATGAGAGCGATGACAGAGAAACAGACACAGCATCAGAGA
GCAGCTACCAGCTCAGGAGATACAAGAAGAGCCCCAGCTCATTAACCAATCTTAGCAGCTCCTCTGGCAT
GACGTCCTTGTCCTCTGCGAGTGGCAGTGTGATGAGCGTTTACAGTGGAGACTTTGGCAACCTAGAAGTG
AAAGGAAGCGTGCAGTTTGCACTCGACTACGTGGAGTCCCTGAAAGAGCTGCATGTGTTTGTGGCCCAGT
GTAAGGATTTAGCAGCAGCAGATGTTAAGAAACAGCGCTCAGATCCGTATGTAAAGACCTATCTGCTACC
AGACAAAGGCAAAATGGGCAAGAAGAAGACACTCGTAGTGAAGAAGACCTTGAATCCTGTATACAACGAG
ATATTGCGGTATAAAATTGAAAGGCAATTCTTAAAGACGCAGAAGTTGAACCTGTCCGTTTGGCATCGGG
ATACATTTAAGCGCAACAGCTTTCTGGGGGAGGTGGAGCTCGACCTGGAAACGTGGGATTGGGACAGCAA
ACAGAACAAACAGCTGAAGTGGTACCCACTGAAGAGGAAGACAGCACCAGTTGCCCTCGAGACAGAAAAC
AGAGGTGAAATGAAACTAGCTCTCCAGTATGTTCCGGAACCAAGCCCTGGCAAAAAGCTTCCTACAACTG
GAGAAGTCCACATCTGGGTGAAGGAATGCCTTGACCTCCCACTGTTGAGGGGCAGCCACCTAAATTCTTT
TGTTAAATGTACCATCCTTCCAGATACCAGTAGAAAAAGTCGCCAGAAGACAAGAGCTGTAGGGAAAACC
ACCAACCCCGTCTTCAACCATACCATGGTGTATGATGGGTTCAGGCCTGAAGATCTGATGGAAGCCTGTG
TAGAACTCACAGTCTGGGACCATTATAAACTAACCAACCAGTTTCTGGGAGGTCTCCGGATCGGCTTTGG
AACAGGAAAAAGCTACGGGACTGAAGTGGATTGGATGGATTCTACTTCTGAGGAAGTTGCTCTCTGGGAG
AAGATGGTAAACTCTCCCAACACTTGGGTTGAAGCGACGCTGCCCCTCCGGATGCTTCTGATTGCCAAGC
TTTCCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001040087
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001040087.2, NP_001035176.1
RefSeq Size 2938 bp
RefSeq ORF 1131 bp
Locus ID 83671
UniProt ID Q99N50
Cytogenetics 7 E1
Gene Summary Isoform 11 acts as a RAB27A effector protein and plays a role in cytotoxic granule exocytosis in lymphocytes. Required for cytotoxic granule docking at the immunologic synapse. Isoform 1 may play a role in melanosome transport and vesicle trafficking. It controls melanosome distribution in the cell periphery and regulates melanocyte morphology. Isoform 1 acts as a positive mediator of mucus secretion by the surface mucus cells of the stomach. Mediates basal mucus secretion by gastric surface cells by promoting the proper granule biognesis and docking of mucus granules with the apical plasma membrane.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks several 5' exons but contains an alternate 5' exon, and it thus differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation from a downstream in-frame start codon, compared to variant 6. The encoded isoform (4, also known as Slp2-c) is shorter at the N-terminus, compared to isoform 6. Both variants 4 and 9 encode isoform 4.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.