Sytl2 (NM_001040088) Mouse Untagged Clone

CAT#: MC211966

Sytl2 (untagged) - Mouse synaptotagmin-like 2 (Sytl2), transcript variant 5, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Sytl2
• Synonyms: AI266830; mKIAA1597; Slp2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211966 representing NM_001040088
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCAAGTCCGTGCCAGCATTTCTTCAAGATGAGGCGAGTGGCAGTGTGATGAGCGTTTACAGTGGAG
  ACTTTGGCAACCTAGAAGTGAAAGGAAGCGTGCAGTTTGCACTCGACTACGTGGAGTCCCTGAAAGAGCT
  GCATGTGTTTGTGGCCCAGTGTAAGGATTTAGCAGCAGCAGATGTTAAGAAACAGCGCTCAGATCCGTAT
  GTAAAGACCTATCTGCTACCAGACAAAGGCAAAATGGGCAAGAAGAAGACACTCGTAGTGAAGAAGACCT
  TGAATCCTGTATACAACGAGATATTGCGGTATAAAATTGAAAGGCAATTCTTAAAGACGCAGAAGTTGAA
  CCTGTCCGTTTGGCATCGGGATACATTTAAGCGCAACAGCTTTCTGGGGGAGGTGGAGCTCGACCTGGAA
  ACGTGGGATTGGGACAGCAAACAGAACAAACAGCTGAAGTGGTACCCACTGAAGAGGAAGACAGCACCAG
  TTGCCCTCGAGACAGAAAACAGAGGTGAAATGAAACTAGCTCTCCAGTATGTTCCGGAACCAAGCCCTGG
  CAAAAAGCTTCCTACAACTGGAGAAGTCCACATCTGGGTGAAGGAATGCCTTGACCTCCCACTGTTGAGG
  GGCAGCCACCTAAATTCTTTTGTTAAATGTACCATCCTTCCAGATACCAGTAGAAAAAGTCGCCAGAAGA
  CAAGAGCTGTAGGGAAAACCACCAACCCCGTCTTCAACCATACCATGGTGTATGATGGGTTCAGGCCTGA
  AGATCTGATGGAAGCCTGTGTAGAACTCACAGTCTGGGACCATTATAAACTAACCAACCAGTTTCTGGGA
  GGTCTCCGGATCGGCTTTGGAACAGGAAAAAGCTACGGGACTGAAGTGGATTGGATGGATTCTACTTCTG
  AGGAAGTTGCTCTCTGGGAGAAGATGGTAAACTCTCCCAACACTTGGGTTGAAGCGACGCTGCCCCTCCG
  GATGCTTCTGATTGCCAAGCTTTCCAAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001040088
• Insert Size: 1011 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001040088.2, NP_001035177.1
• RefSeq Size: 2866 bp
• RefSeq ORF: 1011 bp
• Locus ID: 83671
• UniProt ID: Q99N50
• Cytogenetics: 7 E1
• Gene Summary: Isoform 11 acts as a RAB27A effector protein and plays a role in cytotoxic granule exocytosis in lymphocytes. Required for cytotoxic granule docking at the immunologic synapse. Isoform 1 may play a role in melanosome transport and vesicle trafficking. It controls melanosome distribution in the cell periphery and regulates melanocyte morphology. Isoform 1 acts as a positive mediator of mucus secretion by the surface mucus cells of the stomach. Mediates basal mucus secretion by gastric surface cells by promoting the proper granule biognesis and docking of mucus granules with the apical plasma membrane.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) lacks several 5' exons but contains an alternate 5' exon, it lacks an internal in-frame exon, and it thus differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation from a downstream in-frame start codon, compared to variant 6. The encoded isoform (5) is shorter at the N-terminus, compared to isoform 6.