Ucn3 (NM_031250) Mouse Untagged Clone

CAT#: MC211960

Ucn3 (untagged) - Mouse urocortin 3 (Ucn3), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ucn3
• Synonyms: ucn III
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211960 representing NM_031250
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGATGCCCACCTACTTCCTGCTGCCACTTCTGCTGCTCCTAGGAGGTCCAAGGACAAGCCTCTCCC
  ACAAGTTCTACAACACTGGACCAGTCTTCAGCTGCCTCAACACAGCCCTATCTGAGGTCAAGAAGAACAA
  GCTGGAAGATGTGCCCTTGCTGAGCAAGAAGAGCTTTGGCCACCTGCCCACACAAGACCCCTCAGGGGAA
  GAAGATGACAACCAAACGCACCTCCAGATCAAAAGAACTTTCTCAGGTGCCGCGGGTGGGAATGGAGCTG
  GGAGCACCCGGTACAGATACCAATCCCAGGCACAGCACAAGGGGAAGCTGTACCCAGACAAGCCCAAAAG
  CGACCGGGGCACCAAGTTCACCCTTTCCCTTGATGTTCCCACTAACATCATGAACATCCTCTTCAACATC
  GACAAGGCCAAGAATTTGCGAGCCAAGGCAGCTGCCAATGCTCAGCTCATGGCACAGATTGGGAAGAAGA
  AGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_031250
• Insert Size: 495 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_031250.5, NP_112540.2
• RefSeq Size: 1478 bp
• RefSeq ORF: 495 bp
• Locus ID: 83428
• UniProt ID: Q924A4
• Cytogenetics: 13 A1
• Gene Summary: This gene encodes a member of the corticotropin-releasing hormone peptide family that participates in coordinating autonomic, endocrine, and behavioral responses to stress. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone. The pancreatic islets isolated from mice lacking the encoded protein secrete less insulin in response to high glucose concentrations. Transgenic mice overexpressing the encoded protein exhibit a metabolically favorable phenotype resisting obesity and hyperglycemia on a high-fat diet. [provided by RefSeq, Sep 2016]