Spata2l (NM_030176) Mouse Untagged Clone

CAT#: MC211903

Spata2l (untagged) - Mouse spermatogenesis associated 2-like (Spata2L), (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Spata2l (NM_030176) Mouse Untagged Clone
Symbol Spata2l
Synonyms 2610039E05Rik; AI648233; mKIAA4138
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC211903 representing NM_030176
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCAGCAGCTCACTGTCCGAGGACTATCGCCAGTGCCTGGAGCGCGAGCTGCGGCGCGGCCGCGCGG
GCGTTTGCGGCGACCCCTCGCTGCGCGCGGTGCTCTGGCAGATTCTGGTGGAAGACTTTGACCTGCACGG
GGCGCTACAGGACGATGCGCTAGCCCTGTTCACTGATGGCCTGTGGGGGCGGGCTGACCTGGCACCGGCC
CTCCAAGATCTGGCCCGCGCCTTTGAGCTCCTAGAGCTGGCCGCTGTGCACCTGTACCTGCTGCCCTGGA
GAAAGGAGTTCACCACTATCAAGACCTTCTCAGGGGGCTATGTGCATGTGCTGAAGGGTGTACTCTCTGA
GGAGCTCCTGACTCGAAGCTTCCAGAAGATGGGCTACGTGCGCAGGGACAACCACCGCCTAATGGTGACC
ACCCCACCCCCTGCCTGCCAGCTGGTGCAGGTGGCCCTAGGTTGCTTTGCTCTTCGGTTGGAGTGTGAGA
TCCTAAGTGAGGTCCTGACTCAGCTGGGTACAAGCGTACTACCAGCCGAGGAGCTGCTCCGAGCTCGACG
GGCTAGTGGGGATGTAGCCTCCTGTGTGGCCTGGCTGCAGCAACGCCTGGCCCAAGATGAGGAGCCACCA
CCTCTGCCCCCTCGGGGCACACCTGCCACTTATGGGGCCCCAGTGGACCTGTATCAGGACCTGCAGGAAG
ATGAGAGCTCAGAGGCCAGTCTGTATGGTGAGCCTTCCCCAGGGCTGGACTCGCCTCCTGTGGAGCTGGC
TTACAGGCCACCACTCTGGGAGCAGAGTGCCAAACTATGGGGTTCTGGAGGTCAGCCCTGGGAACCGCCA
GCTGATGATATGCATCGGGCCAGCAGCCCACCATATGGGGCTCTGGAAGAGGAGCTGGAGCCAGAACCCT
CTGCTTTCTCCTTCCTTTCTCTGCGCCGTGAGCTGAGTCGCTCAGGAGACTTAGCTCCCCCTGAGTCCCC
TTCAAGCCCCGGGCAAGCCAGCCCCCGACACAGGCAGGCAGAAGCAGCTGCATCCTCGGCCTATGGGCCT
GCTGTTGAGCCTCTGAGCTACCAGGCACACAGCTGCTTGAGCCCTGGCAACCTACCCACCCTCTGCTGTG
ACACCTGCCGCCAGCTCCATGCTACCCACTGCACTGCCCTATCTGCCTGCCGCCCGACTCATTCACTGCG
CATTCTTCTTGGTGACAACCAGAGACGCCTGTGGCTGCAACGAGCACAGGTGGATAACCTGCTCTATGAC
AGTCCTGGGGCCCATCCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_030176
ORF Size 1281 bp
Insert Size 1281
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_030176.2, NP_084452
RefSeq Size 2380
RefSeq ORF 1281
Locus ID 78779
Cytogenetics 8|8 E1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.