Ntf5 (NM_198190) Mouse Untagged Clone

CAT#: MC211875

Ntf5 (untagged) - Mouse neurotrophin 5 (Ntf5), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ntf5
• Synonyms: 2900040K06Rik; AI462899; NT; NT-; NT-4; NT-5; NT4; NT4/; NT4/5; Ntf; Ntf-; Ntf-5; Ntf4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211875 representing NM_198190
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTCCCTCGCCACTCCTGTTCTCTCCTCCTTTTCCTCTTCCTCCTCCCCAGCGTCCCCATGGAGCCCC
  ACCCCCCATCCTCCACCCTGCCCCCATTTCTGGCCCCTGAGTGGGACCTCTTGTCTCCCCGAGTGGCCCT
  GTCAAGGGGCGCCCCTGCCGGGCCCCCTCTCCTCTTCCTGCTGGAGGCCGGGGCCTATGGAGAGCCGGCA
  GGGGCCCCAGCCAACCGCAGCCGGCGCGGGGTGAGTGAGACCGCACCCGCAAGCCGCCGGGGTGAGCTGG
  CAGTATGCGACGCAGTGAGTGGCTGGGTGACCGACCGGCGGACAGCTGTGGACTTGCGTGGGCGCGAGGT
  GGAGGTGCTGGGCGAGGTGCCTGCGGCAGGTGGCAGTCCCCTGCGTCAGTACTTCTTCGAGACGCGCTGC
  AAGGCCGAAAGCGCTGGGGAAGGTGGCCCAGGTGTGGGCGGAGGGGGTTGTCGCGGCGTGGATCGGAGGC
  ACTGGCTCTCAGAATGCAAGGCTAAGCAGTCCTATGTGCGGGCGTTGACTGCAGACTCCCAGGGCCGCGT
  AGGCTGGCGCTGGATTCGGATCGACACAGCTTGCGTCTGCACGCTCCTCAGCCGAACAGGCCGAGCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_198190
• Insert Size: 630 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_198190.1, NP_937833.1
• RefSeq Size: 2027 bp
• RefSeq ORF: 630 bp
• Locus ID: 78405
• UniProt ID: Q80VU4
• Cytogenetics: 7 29.3 cM
• Gene Summary: This gene encodes a secreted protein belonging to the neurotrophin family of structurally related molecules that play a crucial role in the control of neuronal numbers and of dendritic growth. The encoded preproprotein undergoes post-translational processing to generate non-covalently associated homodimeric functional protein. Mice deficient in the encoded protein exhibit a loss of sensory neurons in the nodose-petrosal and geniculate ganglia, have deficits in long-term memory and hippocampal long-lasting long-term potentiation. [provided by RefSeq, Oct 2015]