Atf7ip2 (NM_029253) Mouse Untagged Clone

CAT#: MC211615

Atf7ip2 (untagged) - Mouse activating transcription factor 7 interacting protein 2 (Atf7ip2), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Atf7ip2
• Synonyms: 4930558K11Rik; BC018510; Get-1; PSM2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211615 representing NM_029253
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAAGTCCAGACAGAAAAAGACAGAAGGTTTTAAAGGCCAAGAAAACAATGCCTACAAGTTACCAGA
  AGCAGTTGGAGATCCTGAACAAGTCAACGAATGTTGAAGCTCCAAAAACAACAGTTGGAACTAATATTCC
  AAATGGTCATAATCAGAAGATGTTTTCAAAAAACAAAGAAAATGTTAAGGTCATGAAAGTTTCAGAGCAA
  ATTAATGAAAATGCTTGTGGGGCTCTGGAAAGACATACAGCACTGCTAGAACAGGTTAAACATTGGATTC
  GACAGGAGATTTGCATGATAAACTGTAATTTATTTGATAAAAAACTGAATGAATTGAATGAACGCATTGG
  GAAGACCCAGTGCAAGAGTAGACATGAAGCAATAGCTGGTGAACTCTTTGTAAAAATAAGAAGACTTCAA
  AAACGCATCAAAACAGTATTATCATCTCAAAGAAATTGTTTGGAACCAAACACATTACCCAGTAATACAG
  TCTGTAAGGTTACAGATTCAGAGGCTATGAATTTGAATGTGACCCAAAAGTCAGTTAAAAGTCGAAGTAA
  AAGAATATCTTCTGTGAACCATACCCCTTTAAACTCTTCAGAAAAAGCAGGTAGAAAGACTAATTTGCCA
  TCAACTTGTGTTGAGTTTGCTTCTGAAAGTAACACTGATGACGTTATGTTGATTTCTGTGAAAAATTCTA
  ATTTGACAACTTCAATTACATCAGAGCAAACAGAAATTAGAAAAAATACATCAAGAAATTTGAGCAACTC
  ACCTAATAGCATGATTAAAGTTGGGCCCGTAGAGAAGAAATTTGATTTTGTTATTGACTTGACAAGAGAA
  GGCCCGTCCAACTACAGCATAGGTAAAGGATGTTTTTACATCTTTCTAAGTAAATGTATGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_029253
• Insert Size: 903 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_029253.1, NP_083529.1
• RefSeq Size: 1047 bp
• RefSeq ORF: 903 bp
• Locus ID: 75329
• UniProt ID: Q3UL97
• Cytogenetics: 16 A1
• Gene Summary: Recruiter that couples transcriptional factors to general transcription apparatus and thereby modulates transcription regulation and chromatin formation. Can both act as an activator or a repressor depending on the context. Mediates MBD1-dependent transcriptional repression, probably by recruiting complexes containing SETDB1. The complex formed with MBD1 and SETDB1 represses transcription and probably couples DNA methylation and histone H3 'Lys-9' trimethylation (H3K9me3) activity (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses different segments for its 3' coding region and 3' UTR, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus when it is compared to isoform 1.