Rab11fip2 (NM_001164367) Mouse Untagged Clone

CAT#: MC211574

Rab11fip2 (untagged) - Mouse RAB11 family interacting protein 2 (class I) (Rab11fip2), transcript variant 2, (10ug)


  "NM_001164367" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rab11fip2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rab11fip2
Synonyms 4930470G04Rik; A830046J09Rik; AW558126; Nrip11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211574 representing NM_001164367
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGAACAACATGACAGCAAGCATGTTTGACTTGTCAATGAAGGACAAGACGAGATCACCTTTTGCAA
AATTAAAAGATAAGATGAAAGGGAGGAAAAGCGACGGGGTGTTTTCTGATACGTCCTCTGCCATCGTTCC
GAGCACTCACATGCCTGATGCCAATCCTGAGTTTTCAAGTGGTGAAATGCAGATGAAATCCAAACCAAAA
AAGCCTTTTCTTTTGGGTCCTCAGCGGCTCTCTTCTGCCCATTCGATGTCTGATTTAACTGGGTCCCACT
TATCTTCTGAGAAGCTGAAGTCCAGCACTGTGGGTCCAACACATCTTCTCAGTCGCCAGATAGATTCCTT
TGGAGTTGTTCCAGAAAGTGGAAGTCTCAAGTCTCCACACAGACGAACACTAAGCTTTGATACTTCTAAA
TTGAACCAACCTGGCAGCATTGTGGATGAAGGTGAACACTCTTTTGGAAGACAGAGTGACCCATTTACAA
ATGTGACTGCTTCATTACCCCAAAAATTTGCAACACTGCCAAGGAAGAAGAATCCATTTGAAGAAAGCAG
TGAGCCATGGGACAGCAGCATGAATTTATTCTCAAAACCAATTGAAGTCAGGAAAGAAAGTAAGAGAGAG
AAAAGGGAGAAGGTGAGCCTCTTTGAAAGAGTGACTGGCAAGAGAGATAGCAGGAGACCTGACAAGCTGA
ACAATGGTGGATCTGATAGCCCATGTGACTTGAAATCACCTAGTGCTTTTAGTGAAAACCGGCAGGACTA
TTTTGAATATGAGTCAACTAACCCGTTTACAGCAAAATTCAGGGCTTCAACTATAATGCCATCTTCAAGT
TTTCATGTGAATCCAACAAGCAGTGAAGACCTCAGGAAAATCCCGGACAACAATCCTTTCGATGCCACGG
CTGGGTACCGGAGTCTGACCTACGAAGAGGTGCTGCAGGAGCTGGTGAAGCACAAAGAACTCCTTCGGAG
GAAGGACACCCATATCCGGGAGCTAGAGGACTACATTGACAACCTCCTCGTCAGGGTGATGGAAGAGACA
CCCAGCATCCTGCGAGTGCCCTACGAGCCATCCAGAAAAGCTGGCAAGTTCACCAATAGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164367
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164367.1, NP_001157839.1
RefSeq Size 5373 bp
RefSeq ORF 1113 bp
Locus ID 74998
UniProt ID G3XA57
Cytogenetics 19 D3
Gene Summary A Rab11 effector binding preferentially phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) and phosphatidic acid (PA) and acting in the regulation of the transport of vesicles from the endosomal recycling compartment (ERC) to the plasma membrane. Involved in insulin granule exocytosis. Also involved in receptor-mediated endocytosis and membrane trafficking of recycling endosomes, probably originating from clathrin-coated vesicles. Required in a complex with MYO5B and RAB11 for the transport of NPC1L1 to the plasma membrane. Also acts as a regulator of cell polarity. Plays an essential role in phagocytosis through a mechanism involving TICAM2, RAC1 and CDC42 Rho GTPases for controlling actin-dynamics.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. This variant also contains an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.