Vkorc1l1 (NM_027121) Mouse Untagged Clone
CAT#: MC210964
Vkorc1l1 (untagged) - Mouse vitamin K epoxide reductase complex, subunit 1-like 1 (Vkorc1l1), transcript variant 1, (10ug)
"NM_027121" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Vkorc1l1 |
Synonyms | 2310024K08Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NM_027121.3
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCGCCCGTCCTGCTGAGAGTGTCGGTGCCGCGTTGGGAACGGGTGGCCCGGTATGCAGTGTGCG CCGCCGGGATCCTGCTCTCCATCTACGCCTACCACGTGGAGCGGGAGAAGGAGAGGGACCCGGAGCACCG GGCCCTCTGCGACCTGGGGCCCTGGGTGAAGTGCTCCGCCGCCCTGGCCTCCAGATGGGGTCGAGGATTT GGTCTTTTGGGTTCCATTTTTGGAAAAGATGGTGTATTAAACCAGCCAAACAGTGTCTTTGGACTTATAT TTTATATACTACAGTTATTACTTGGCATGACAGCCAGCGCAGTTGCAGCTCTGGTCCTCATGACCTCCTC CATTGTGTCTGTGGTGGGCTCTTTGTACCTGGCCTACATTCTGTACTTTGTGCTGAAAGAGTTTTGCATC ATCTGCGTCACCACATATGTGCTGAACTTCCTCCTCCTCATCATCAATTACAAACGACTAGTTTATTTGA ATGAGGCCTGGAAGCGACAGCTGCAGCCTAAGGAAGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_027121 |
Insert Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_027121.3, NP_081397.1 |
RefSeq Size | 1113 bp |
RefSeq ORF | 531 bp |
Locus ID | 69568 |
UniProt ID | Q6TEK5 |
Cytogenetics | 5 G1.3 |
Gene Summary | Involved in vitamin K metabolism. Can reduce inactive vitamin K 2,3-epoxide to active vitamin K (in vitro), and may contribute to vitamin K-mediated protection against oxidative stress. Plays a role in vitamin K-dependent gamma-carboxylation of Glu residues in target proteins.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215687 | Vkorc1l1 (tGFP-tagged) - Mouse vitamin K epoxide reductase complex subunit 1-like 1 (Vkorc1l1) transcript variant 1, (10ug) |
USD 500.00 |
|
MR215687 | Vkorc1l1 (Myc-DDK-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1-like 1 (Vkorc1l1), transcript variant 1 |
USD 300.00 |
|
MR215687L3 | Lenti ORF clone of Vkorc1l1 (Myc-DDK-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1-like 1 (Vkorc1l1), transcript variant 1 |
USD 600.00 |
|
MR215687L4 | Lenti ORF clone of Vkorc1l1 (mGFP-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1-like 1 (Vkorc1l1), transcript variant 1 |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review