H2bw2 (NM_027067) Mouse Untagged Clone

CAT#: MC210926

H2bfm (untagged) - Mouse RIKEN cDNA 1700014N06 gene (1700014N06Rik), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: H2bw2
• Synonyms: 1700014N06Rik; H2bfm; H2bfw; H2BL; H2bl2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210926 representing NM_027067
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGTCTACCACGGCTATGGACGTTCTGGAGGAGCTATCTTCGGATAGTTCCGAAAAACAGGTACAAC
  CAAGAAAGCCTGAGAAAGCTAAAAGGGAAAAGGACAAACCAAAGAAAGGGGGGCCGGAGAAGAAGGCCAA
  GAAAGAGAAACAGGAGAAAGCAAAGCCGGAGAAAAAGCCGAAGAAGAAGCCAGAGAAAGAGAAGCCGGAG
  GGAGAGAAGCTGGAGAAGAAACCCAAGAAAGACAAGCGGGAGAAAGCGAAGCCGAAGAAGAAGCCCGAGC
  AAGAGAACCGTGAGCAAGAGACTCCTGAGCAGGAGAAGCCTGAGGTGCAGCGGCGTCGCTCACTTCACCA
  AAGCATCAGGGAAGATGAGCGTAGAGCCCGTCTGATCAGACGCCGTAAGAACAGCTTCGCTATCTACTTT
  CCGAAGGTGCTGAAAAATATCCACGTGGGTCTCTCCCTCTCGCAGCGGTCTGTGAACATCCTGGATTCAT
  TCGTGAAGGATATGTTTGAAAGAATTGCATCCGAAGCCAGCTTCTTGGCGCGTCAAGCCAGAAACTCTAC
  TATCAACTCCAGAGAGATCCAGACCGCTATTCGACTTCTGCTTCCTGGCGAGCTCTGCCGGCGTGCAGTG
  GCTGAAGGAACCATGGCGATGGTCCGGTATATCTCCAACAAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_027067
• Insert Size: 675 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_027067.2, NP_081343.1
• RefSeq Size: 1049 bp
• RefSeq ORF: 675 bp
• Locus ID: 69389
• Cytogenetics: X F1
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-independent histone that is a member of the H2B histone family. [provided by RefSeq, Nov 2015]