Wdfy1 (NM_027057) Mouse Untagged Clone

CAT#: MC210914

Wdfy1 (untagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Wdfy1
• Synonyms: 1700013B03Rik; 1700120F24Rik; FENS-1; Jr1; mKIAA1435; WDF1; ZFYVE17
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210914 representing NM_027057
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGCGGAGATCCACTCCAGGCCTCAGAGCAGCCGCCCGGTGCTGCTGAGCAAGATAGAGGGCCACC
  AGGACGCCGTCACCGCCGCGCTGCTCATCCCCAAGGAGGACGGCGTGATCACCGCTAGCGAGGACAGAAC
  CATCCGAGTATGGCTGAAAAGAGACAGCGGCCAGTACTGGCCCAGCATCTACCACACAATGGCCTCCCCT
  TGCTCTGCCATGGCATACCACCACGACAGCAGGCGGATATTTGTGGGCCAGGATAATGGGGCTGTGATGG
  AATTTCACGTTTCTGAAGATTTTAATAAAATGAATTTTATCAAGACCTATCCAGCCCACCAGAACCGCGT
  GTCTGCTATCATCTTCAGCCTGGCTGCCGAGTGGGTGATCAGCACTGGCCACGACAAGTGTGTGAGCTGG
  ATGTGCACGCGCAGCGGGAATATGCTTGGCCGCCACTTCTTCTCGTCGTGGGCTTCCTGTTTGCAGTATC
  CTTCAGAGTGCCGGACCCCTCCTCCCATTGTTAGCTGCTTTGAAGACAGAATGACTCCTGTGGATTTATC
  CTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_027057
• Insert Size: 564 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_027057.3, NP_081333.1
• RefSeq Size: 719 bp
• RefSeq ORF: 564 bp
• Locus ID: 69368
• Cytogenetics: 1 C4
• Gene Summary: Positively regulates TLR3- and TLR4-mediated signaling pathways by bridging the interaction between TLR3 or TLR4 and TICAM1. Promotes TLR3/4 ligand-induced activation of transcription factors IRF3 and NF-kappa-B, as well as the production of IFN-beta and inflammatory cytokines (PubMed:25736436).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks multiple exons and uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform 2 which has a shorter and distinct C-terminus compared to isoform 1.