Scnm1 (NM_001163573) Mouse Untagged Clone
CAT#: MC210878
Scnm1 (untagged) - Mouse sodium channel modifier 1 (Scnm1), transcript variant 2, (10ug)
"NM_001163573" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Scnm1 |
Synonyms | 3110001I17Rik; Scnm1-ps |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210878 representing NM_001163573
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTTTTAAGAGGGAAGGGGACGACTGGAGTCAACTCAATGTGCTCAAAAAACGGAGAGTTGGGGACC TGCTGGCTAGTTACATCCCTGAGGACGAGGCACTGATGCTGCGGGATGGACGCTTTGCTTGTGCCATCTG CCCCCATCGACCAGTACTAGACACGCTGGCCATGTTGACAGCCCACCGTGCAGGCAAGAAGCATTTGTCC AGTCTGAAGCTTTTCTATGGCAAAAAGCAAACAGGCAAGGGAACAGAGCAAAATCCAAGACAGCAGAACG AATTGAAGACAGAAAGCAAAACTGAGGCTCCTTTGCTAACCCAGACTCGAATCATCACCCAGAATGCTCT ACACAGAGCTCCCCACTATAACAGTTGCTGCCGGAGGAAGCACAGCTCTGGATGGGTCCCAGATGGACGA GGTCGATGGATAAAGGATGAAAATGTTGAGTTTGACTCTGATGAGGAAGAGCCCCCCGATCTCCCCTTGG ACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163573 |
Insert Size | 495 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001163573.1, NP_001157045.1 |
RefSeq Size | 693 bp |
RefSeq ORF | 495 bp |
Locus ID | 69269 |
UniProt ID | Q8K136 |
Cytogenetics | 3 40.74 cM |
Gene Summary | Mutations in the voltage-gated sodium channel gene Scn8a lead to neurological problems in mice. For one particular mutation, Scn8amedJ, mice live to adulthood but have tremors and muscle weakness, among other problems, in all strains except those derived from C57BL6 mice. In these strains, the product of the Scnm1 gene (229 aa) partially overcomes the effects of the Scn8amedJ mutation. However, in C57BL6-derived mice, a one nt change in the penultimate exon creates a premature stop codon, truncating the Scnm1 protein at 186 aa. This truncated protein lacks the ability to overcome the effects of the Scn8amedJ mutation, and these mice suffer paralysis and juvenile death. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (2) lacks the exon containing the stop codon compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215391 | Scnm1 (tGFP-tagged) - Mouse sodium channel modifier 1 (Scnm1) transcript variant 2, (10ug) |
USD 365.00 |
|
MR215391 | Scnm1 (Myc-DDK-tagged) - Mouse sodium channel modifier 1 (Scnm1), transcript variant 2 |
USD 165.00 |
|
MR215391L3 | Lenti ORF clone of Scnm1 (Myc-DDK-tagged) - Mouse sodium channel modifier 1 (Scnm1), transcript variant 2 |
USD 465.00 |
|
MR215391L4 | Lenti ORF clone of Scnm1 (mGFP-tagged) - Mouse sodium channel modifier 1 (Scnm1), transcript variant 2 |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review