Naxd (NM_026995) Mouse Untagged Clone

CAT#: MC210873

Carkd (untagged) - Mouse carbohydrate kinase domain containing (Carkd), transcript variant 1, (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Naxd (NM_026995) Mouse Untagged Clone
Symbol Naxd
Synonyms 0710008K08Rik; 2810407E01Rik; Carkd
Vector pCMV6-Entry
Sequence Data
>MC210873 representing NM_026995
Red=Cloning site Blue=ORF Orange=Stop codon

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGC
GCC
C

ATGGGAGTCCGCTGTGTGGCAATCCGCGCCTGCGGGGGAGGTAAGATCGATCCGGGCGTCCCGCGGATGG
CCGTTCACGCCTGTGGGGCTGCGGCGGCCGTGGTGGCGCTGCTTTCCGCCGCGATCGCGCTCCAGTGGTC
GCCGCTGTACGCAGTTTTACAGAGAGCACTGTCTCTCCATACAGCACATGCGACAAAGGACATGGAGAAC
CTTTTTCAGCTGGTGAGAAACATTGTGCCTGCTCTGACGTCGAAGAAGCACAAGGGGCAAGATGGAAGAA
TAGGCATAGTCGGGGGCTGCCAAGAGTACACAGGAGCACCATATTTTGCAGGAATCTCAGCCTTGAAAGT
GGGTGCAGATTTGACCCACGTGTTCTGTGCCAGGGAGGCAGCGCCAGTGATCAAGTCCTACAGCCCAGAG
CTGATCGTCCACCCAGTCCTTGACAGTTCCAATGCTGTTGAGGAGGTGGAGAAATGGCTCCCCAGGCTGC
ATGCCCTTGTCGTGGGACCTGGCCTAGGTAGGGATGACCTTCTTCTCAACAATGTCAGGGGCATTTTGGA
ATCAACCAAGGCCAGGGACATCCCTGTGGTCATTGATGCGGACGGCCTGTGGCTCGTTGCTCAGCAGCCA
GCCCTCATCCATAGTTACCACAAGGCCATTCTCACCCCCAACCACGTGGAGTTCAGCAGACTCTGGGAAG
CTGTGCTCAGTAGTCCTATGGACAGCAACGATCTCAAGGGCTCCACACTGAAGCTCAGCCAGGCCCTGGG
GAACATCACAGTGGTCCAGAAAGGAGAGCAGGACCTGATCTCCAATGGCCAGCAGGTGCTTGTGTGTAAC
CAAGAAGGCAGCAGTCGCAGGTGTGGCGGGCAAGGCGATCTCCTGTCAGGCTCCCTGGGTGTCATGGTGC
ACTGGGCCCTCCGTGCTGGACCAGAGAAAACAAATGGCTCCAGCCCACTCCTGGTGGCTGCCTGGGGCGC
CTGCACACTCACAAGGGAGTGTAACCGGCAGGCCTTCCAGAAGTACGGGCGCTCTACAACCACTACCGAC
ATGATCACAGAGGTAGGAACTGCCTTCAGCAGGCTCTTCACGACCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites AscI-MluI     
Tag Tag Free
ACCN NM_026995
ORF Size 1098 bp
Insert Size 1098
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_026995.4, NP_081271
RefSeq Size 1382
RefSeq ORF 1098
Locus ID 69225
Cytogenetics 8|8 A1.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.