Kmt5a (NM_030241) Mouse Untagged Clone

CAT#: MC210666

Setd8 (untagged) - Mouse SET domain containing (lysine methyltransferase) 8 (Setd8), (10ug)


  "NM_030241" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Kmt5a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Kmt5a
Synonyms 2410195B05Rik; AA617402; AW536475; PR-SET7; PR/SET07; Setd8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210666 representing NM_030241
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTAGAGGCAGGAAGATGTGCAAGCCCCGCGCGGTGGAGGCGGCGGCGGCGGCGGTGGCGGCGACGG
CCCCGGGCCCGGAGATGGTGGAGCAGAGGGGCCCGGGGAGGCCCCGCAGCGACGGGGAGAACGTGTTTGC
TGGGCAGTCAAAGATCTATGCCTACATGAGTCCGAACAAGTGCTCTGCAATGCGCTCTCCACTTCAGGAA
GAGAACTCGGTTGCCCATCATGAGGTCAAATGCCCGGGGAAACCATTAGCTGGAATCTACAGGAAGCGAG
AAGAGAAAAGGAACACCGGGAACGTTATACGAAGCGCTGTGAAGTCAGATGAACAGAAGAGCAAAGACAC
CAGGAGAGGTCCCCTGGCGCCTTTTCCAAACCAAAAATCCGAAGCAGCAGAACCTCCAAAAACTCCACCC
CCATCATGTGATTCTACCAATGTAGCAGTCGCTAAGCAAGCCCTGAAAAAGTCCCTCAAGGGCAAACAGG
CCCCTCGGAAAAAGTCTCAAGGGAAAACCCAGCAGAATAGAAAACTCACAGATTTCTACCCTGTGCGGAG
GAGTTCCCGGAAGAGCAAAGCTGAGCTGCAGTCTGAAGAAAGGAAGAAAATAGATGAGCTGATTGAGAGC
GGGAAGGAAGAAGGCATGAAGATTGATCTAATTGATGGCAAAGGCAGGGGTGTGATCGCTACCAAGCAGT
TCTCCAGGGGAGACTTTGTGGTAGAATACCATGGGGACCTCATTGAAATCACTGATGCCAAGAAGCGGGA
GGCTCTGTACGCACAGGACCCCTCCACTGGCTGCTACATGTACTATTTTCAGTATCTGAGCAAAACCTAC
TGCGTGGATGCCACTCAAGAAACGAACCGCCTAGGGAGACTCATCAATCACAGTAAGTGTGGGAACTGCC
AGACCAAACTGCACGACATCGACGGCGTGCCTCACCTCATCCTCATCGCCTCCCGAGACATCGCAGCTGG
GGAGGAGCTCCTGTACGACTATGGGGACCGAAGCAAGGCCTCCATCGAAGCCTACCCCTGGCTGAAGCAC
TAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_030241
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030241.3, NP_084517.2
RefSeq Size 2738 bp
RefSeq ORF 1053 bp
Locus ID 67956
UniProt ID Q2YDW7
Cytogenetics 5 F
Gene Summary Protein-lysine N-methyltransferase that monomethylates both histones and non-histone proteins. Specifically monomethylates 'Lys-20' of histone H4 (H4K20me1). H4K20me1 is enriched during mitosis and represents a specific tag for epigenetic transcriptional repression. Mainly functions in euchromatin regions, thereby playing a central role in the silencing of euchromatic genes. Required for cell proliferation, probably by contributing to the maintenance of proper higher-order structure of DNA during mitosis. Involved in chromosome condensation and proper cytokinesis. Nucleosomes are preferred as substrate compared to free histones. Mediates monomethylation of p53/TP53 at 'Lys-382', leading to repress p53/TP53-target genes. Plays a negative role in TGF-beta response regulation and a positive role in cell migration (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.