Rnls (NM_001146342) Mouse Untagged Clone
CAT#: MC210626
Rnls (untagged) - Mouse renalase, FAD-dependent amine oxidase (Rnls), transcript variant 2, (10ug)
"NM_001146342" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rnls |
Synonyms | 6530404N21Rik; AI452315; AW060440; C10orf59 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210626 representing NM_001146342
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCAGCTCCTCAGATTCTGGAACTTCAAGGTGACATTGTGAACTTAATTAGTGAACGCCAGAGGGAGC AACTGAAATCTGTGAGCTACTCCTCTCGCTATGCTCTGGGCCTCTTTTATGAAGTAGGCATGAAGATTGG TGTCCCTTGGTCCTGCCGCTACCTCAGCAGTCACCCCTGCATATGCTTCATCTCCATTGATAATAAGAAG CGCAATATAGAGTCATCAGAATGTGGTCCATCCGTGGTGATCCAAACCACTGTCCCATTTGGAGTTCAAC ACTTGGAGGCCAGTGAGGCGGATGTGCAGAAGTTAATGATCCAGCAATTGGAAACCATTCTGCCGGGTTT GCCTCAGCCAGTTGCTACCATATGCCATAAATGGACATATTCACAGGTTACAAGCTCAGTTTCCGACAGA CCTGGTCAGATGACTCTTCATCTCAAGCCTTTCCTGGTGTGCGGAGGGGATGGATTTACTCACTCCAACT TCAATGGCTGCATCTCCTCTGCCCTGAGTGTCATGAAAGTTTTAAAGCGTTATATTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146342 |
Insert Size | 549 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001146342.2, NP_001139814.2 |
RefSeq Size | 1383 bp |
RefSeq ORF | 549 bp |
Locus ID | 67795 |
UniProt ID | A7RDN6 |
Cytogenetics | 19 C1 |
Gene Summary | Catalyzes the oxidation of the less abundant 1,2-dihydro-beta-NAD(P) and 1,6-dihydro-beta-NAD(P) to form beta-NAD(P)(+). The enzyme hormone is secreted by the kidney, and circulates in blood and modulates cardiac function and systemic blood pressure. Lowers blood pressure in vivo by decreasing cardiac contractility and heart rate and preventing a compensatory increase in peripheral vascular tone, suggesting a causal link to the increased plasma catecholamine and heightened cardiovascular risk. High concentrations of catecholamines activate plasma renalase and promotes its secretion and synthesis.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG216631 | Rnls (tGFP-tagged) - Mouse renalase FAD-dependent amine oxidase (Rnls) transcript variant 2, (10ug) |
USD 530.00 |
|
MR216631 | Rnls (Myc-DDK-tagged) - Mouse renalase, FAD-dependent amine oxidase (Rnls), transcript variant 2 |
USD 330.00 |
|
MR216631L3 | Lenti ORF clone of Rnls (Myc-DDK-tagged) - Mouse renalase, FAD-dependent amine oxidase (Rnls), transcript variant 2 |
USD 630.00 |
|
MR216631L4 | Lenti ORF clone of Rnls (mGFP-tagged) - Mouse renalase, FAD-dependent amine oxidase (Rnls), transcript variant 2 |
USD 630.00 |
{0} Product Review(s)
Be the first one to submit a review