Spc25 (NM_025565) Mouse Untagged Clone
CAT#: MC210369
Spc25 (untagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Spc25), (10ug)
"NM_025565" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Spc25 |
Synonyms | 2600017H08Rik; 2610205L13Rik; Spbc; Spbc25 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210369 representing NM_025565
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTTTGAAATTAAAGGAAGAAGAGAGGATGACTGAGATGATTCTGGAGTATAAAAACCAGCTCTGTA AGCAGAATAAGCTCATTCAAGAAAAGAAAGAGAATGTGTTGAAGATGATTGCTGAAGTAAAAGGCAAGGA GCAAGAGTCGGAAGAGCTGACTGCTAAAATCCAGGAGCTCAAGGAAGAGTACGCTAGGAAGAGGGAAACC ATTTCCACTGCTAACAAAGCTAATGAAGAGAGATTGAAAGGACTGCAGAAATCAGCGGATCTGTATAGAG ATTACCTTGGACTAGAAATTAGAAAGATTCACGGTAATAAATTGCAGTTTATATTTACTAGTATTGACCC TAAGAATCCTGAGAGCCCATATATGTTTTCCATGAGCATAAATGAAGCTAAGGAATATGAAGTGTACGAC AGTTCGCCTCATCTTGAGTGCCTAGCAGAATTTCAGGAGAAAGTCAGGAAGACCAACAATTTTTCAGCTT TTCTTGCCAATATTCGGAAGGCTTTTATAGCTAAGGTTCATAATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_025565 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_025565.4, NP_079841.1 |
RefSeq Size | 1235 bp |
RefSeq ORF | 537 bp |
Locus ID | 66442 |
UniProt ID | Q3UA16 |
Cytogenetics | 2 C2 |
Gene Summary | This gene encodes a component of the kinetochore-associated NDC80 protein complex, which is required for the mitotic spindle checkpoint and for microtubule-kinetochore attachment. During meiosis in mouse, the protein localizes to the germinal vesicle and then is associated with the chromosomes following germinal vesicle breakdown. Knockdown of this gene in oocytes results in precocious polar body extrusion, chromosome misalignment and aberrant spindle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (4) differs in the 5' UTR and lacks an exon in the 5' coding region, which results in use of a downstream start codon compared to variant 1. It encodes isoform (2), which has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221063 | Spc25 (tGFP-tagged) - Mouse SPC25 NDC80 kinetochore complex component homolog (S. cerevisiae) (Spc25), (10ug) |
USD 530.00 |
|
MR221063 | Spc25 (Myc-DDK-tagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Spc25) |
USD 330.00 |
|
MR221063L3 | Lenti ORF clone of Spc25 (Myc-DDK-tagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Spc25) |
USD 630.00 |
|
MR221063L4 | Lenti ORF clone of Spc25 (mGFP-tagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Spc25) |
USD 630.00 |
{0} Product Review(s)
Be the first one to submit a review