Tbata (NM_001017409) Mouse Untagged Clone

CAT#: MC210247

Tbata (untagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 6, (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tbata (NM_001017409) Mouse Untagged Clone
Symbol Tbata
Synonyms 1700021K02Rik; AI428928; Spatial; Titest
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC210247 representing NM_001017409
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

CTGTTTCTGGGGAATGTATATAAGGGGAGTTTAGCACCTCGTAGGGATGAGGTGACTAGTCCAAAGGCAG
AGCCCCAGCCAGAGACGAAGCCGGAGAACCTTCCAAGGAGCCACGGGGATGTTGGGCTCCAGAAAGAGAC
TGTGGTCCCAGGCATTGTGGATTTCGAGCTGATCCATGAGGAGCTGAAGACCACAAAGCCCCAAACATCA
CAACCAACACCCAGTGCCTACCGCTTTGGACGCCTAAGCCACCATTCCTTCTTCTCGAGGCACCACCCCC
AACCACAGCGAGTGACTCATATCCAAGATATCGCTGGGAAGCCTGTCTGCGTGGTCAGGGACGAGTTCTC
TCTGTCGGCCTTGACTCAGCCCACATTCTTATCCCGCTGTCTGATGGGGATGCCCACCATCTCTGTCCCC
ATTGGGGATCCACAGTCCAATCGGAACCCCCAGCTTTCTACTTCTGTCCTGAAGACACAGGGAGGACAAA
CAACACCTACCGCCCCCCACCCCCATCTTTCCTGTCCTCTCAGACACCTGGAGGAAGAAACTGAAGGACC
TGGCTTCCCGAGTGACTGTCTTCACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001017409
ORF Size 588 bp
Insert Size 588
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001017409.1, NP_001017409
RefSeq Size 999
RefSeq ORF 588
Locus ID 65971
Cytogenetics 10|10 B4
Gene Summary This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (6) uses an alternate acceptor splice site in one of the coding exons and in the last exon, compared to transcript variant 3. The encoded isoform (6, also known as Spatial-beta) is missing an internal segment and has a different C-terminus compared to short isoform 3. This variant initiates translation from a non-AUG (CUG) start site and is highly expressed in the thymus. COMPLETENESS: complete on the 3' end.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.