Cldn12 (NM_001193660) Mouse Untagged Clone

CAT#: MC210234

Cldn12 (untagged) - Mouse claudin 12 (Cldn12), transcript variant 3, (10ug)


  "NM_001193660" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cldn12"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cldn12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210234 representing NM_001193660
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCTGCCGAGATGTCCACGCAGCCACCGTCCTGTCCTTCCTGTGTGGTATTGCCTCTGTCGCAGGCC
TCTTTGCGGGGACTCTGCTTCCTAACTGGAGGAAACTGCGGCTGATCACATTCAACAGAAACGAGAAGAA
CCTGACGATTTACACGGGCCTGTGGGTGAAGTGTGCCCGGTATGATGGAAGCAGTGACTGCCTGATGTAC
GACCGTACGTGGTACCTGTCGGTTGACCAGCTGGACCTGCGTGTCCTCCAGTTTGCCCTGCCTCTCAGCA
TCGTGATCGCAATGGGTGCCTTGCTACTCTGCCTGATTGGAATGTGTAACACGGCCTTCAATTCTTCCGT
GCCTAACATCAAACTGGCCAAGTGTCTGGTCAATAGTGCAGGCTGCCACCTGGTGGCCGGACTCCTGTTT
TTTCTGGCAGGTACCGTGAGCCTCTCTCCGTCCATCTGGGCCATCTTTTATAACAGCCATCTCAACAGGA
AGTTTGAGCCGGTCTTTACCTTTGACTATGCAGTATTTGTCACTATTGCTAGCTCAGGGGGTCTGTTTAT
GACTGCTCTCCTGCTGTTCGTTTGGTATTGTGCATGCAAGTCTTTGTCCTCTCCTTTCTGGCAACCGCTG
TACTCTCACGCTCCCGGGATGCACACTTACTCACAGCCCTATTCATCACGGTCCCGCCTCTCTGCCATTG
AAATCGACATTCCAGTAGTCTCACACAGCACTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001193660
Insert Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001193660.1, NP_001180589.1
RefSeq Size 3752 bp
RefSeq ORF 735 bp
Locus ID 64945
UniProt ID Q9ET43
Cytogenetics 5 A1
Gene Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene, along with several other family members, is expressed in the inner ear. The protein encoded by this gene and another family member, claudin 2, are critical for vitamin D-dependent Ca2+ absorption between enterocytes. Multiple alternatively spliced transcript variants encoding the same protein have been found. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.