Izumo1r (NM_176807) Mouse Untagged Clone

CAT#: MC210231

Folr4 (untagged) - Mouse folate receptor 4 (delta) (Folr4), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Izumo1r
• Synonyms: 0910001L11Rik; C86255; Folbp3; Folr4; Juno
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210231 representing NM_176807
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCACAGTGGTGGCAGATCCTCTTGGGGTTGTGGGCAGTCCTACCCACCTTGGCAGGGGACAAACTGC
  TCAGCGTCTGCATGAATTCCAAGCGCCACAAGCAAGAACCTGGCCCAGAAGACGAACTCTACCAGGAGTG
  CAGGCCTTGGGAGGACAATGCCTGCTGCACACGTTCCACAAGTTGGGAAGCCCACCTTGAGGAGCCCTTG
  CTCTTTAACTTCAGCATGATGCACTGTGGACTGCTGACCCCGGCCTGTCGCAAGCACTTCATCCAGGCCA
  TCTGCTTCCATGAGTGTTCCCCCAACCTGGGGCCTTGGATCCAGCCGGTGGTCCCAAACGGGCAGGAAGA
  GCAGCGGGTTTGGGGCGTGCCGCTGTGCCAGGAGGATTGTGAGGACTGGTGGCGAGCCTGCCACTCATCT
  TTGACTTGTAAATCCAACTGGCTCCATGGCTGGGACTGGAGTGAGGTCAAGGGTCTTCTATCAATGAGAC
  TACCGTTTATAGAACTACCACTGCCATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_176807
• Insert Size: 519 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_176807.4, NP_789777.1
• RefSeq Size: 1239 bp
• RefSeq ORF: 519 bp
• Locus ID: 64931
• Cytogenetics: 9 A2
• Gene Summary: Receptor for IZUMO1 present at the cell surface of oocytes (oolemma), which is essential for species-specific gamete recognition and fertilization (PubMed:24739963, PubMed:26859261, PubMed:27309808, PubMed:27416963). The IZUMO1:IZUMO1R/JUNO interaction is a necessary adhesion event between sperm and egg that is required for fertilization but is not sufficient for cell fusion (PubMed:24739963, PubMed:26859261, PubMed:27309808). The ligand-receptor interaction probably does not act as a membrane 'fusogen' (PubMed:24739963, PubMed:26859261, PubMed:27309808). Does not bind folate (PubMed:24739963).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains a different segment for its 3' CDS and 3' UTR, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus.