Pmaip1 (NM_021451) Mouse Untagged Clone

CAT#: MC210182

Pmaip1 (untagged) - Mouse phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pmaip1
• Synonyms: Noxa
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210182 representing NM_021451
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCCGGGAGAAAGGCGCGTCGGAACGCGCCAGTGAACCCAACGCGGGCAGAGCTACCACCTGAGTTCG
  CAGCTCAACTCAGGAAGATCGGAGACAAAGTGTATTGCACGTGGAGTGCACCGGACATAACTGTGGTTCT
  GGCGCAGATGCCTGGGAAGTCGCAAAAGAGCAGGATGAGGAGCCCAAGCCCAACCCGGGTGCCAGCAGAC
  TTGAAGGACGAGTGTGCTCAACTCCGGAGGATTGGAGACAAAGTGAATTTACGGCAGAAACTTCTGAATT
  TGATTTCCAAGCTCTTCAATTTAGTAACCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_021451
• Insert Size: 312 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021451.2, NP_067426.1
• RefSeq Size: 2654 bp
• RefSeq ORF: 312 bp
• Locus ID: 58801
• UniProt ID: Q9JM54
• Cytogenetics: 18 E1
• Gene Summary: Promotes activation of caspases and apoptosis. Promotes mitochondrial membrane changes and efflux of apoptogenic proteins from the mitochondria. Contributes to p53/TP53-dependent apoptosis after radiation exposure. Promotes proteasomal degradation of MCL1. Competes with BIM/BCL2L11 for binding to MCL1 and can displace BIM/BCL2L11 from its binding site on MCL1 (By similarity). Competes with BAK1 for binding to MCL1 and can displace BAK1 from its binding site on MCL1.[UniProtKB/Swiss-Prot Function]