Mtch2 (NM_019758) Mouse Untagged Clone
CAT#: MC210054
Mtch2 (untagged) - Mouse mitochondrial carrier homolog 2 (C. elegans) (Mtch2), nuclear gene encoding mitochondrial protein, (10ug)
"NM_019758" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mtch2 |
Synonyms | 2310034D24Rik; 4930539J07Rik; HSPC0; HSPC032 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_019758, the custom clone sequence may differ by one or more nucleotides
ATGGCGGACGCGGCCAGTCAGGTGCTCCTGGGCTCCGGTCTCACCATCCTGTCCCAGCCGCTCATGTACG TGAAAGTGCTCATCCAGGTGGGATATGAGCCTCTTCCTCCAACAATAGGACGAAATATTTTTGGGCGACA AGTATGTCAGCTTCCTGGCCTCTTTTGCTATGCTCAGCACATTGCAAGCATCGATGGGAGGCGTGGGTTG TTCACAGGCTTGACTCCAAGACTGTGTTCAGGAGTCCTTGGAACTGTGGTCCATGGGAAAGTCTTACAGT ATTACCAGGAGTCTGAGAAACCTGAGGAGTTAGGATCTGTAACTGTACAAAAAGAATATTCATCCTCCTT TGACCGAGTTATCAAAGAGACAACTCGAGAGATGATTGCTCGTTCTGCTGCTACCCTCATTACACATCCC TTCCACGTGATCACTCTGAGGTCCATGGTACAGTTTATTGGCAGAGAGTCTAAGTACTGTGGACTGTGTG ACTCCATAGTAACCATCTACCGGGAAGAAGGCATCGTAGGATTTTTTGCGGGTCTCATTCCTCGCCTCCT AGGTGACATCATTTCTTTGTGGCTGTGTAACTCACTGGCCTATCTCATCAATACCTATGCACTGGACAGT GGGGTTTCTACCATGAATGAAATGAAAAGTTACTCCCAAGCTGTCACAGGATTCTTTGCCAGTATGTTGA CATATCCCTTTGTGCTTGTATCTAATCTTATGGCCGTCAACAACTGTGGGCTTGCTGGTGGATCTCCTCC TTATTCCCCAATATACACTTCTTGGATAGATTGCTGGTGCATGCTACAAAAAGCGGGAAATATGAGCCGA GGAAACAGCTTGTTTTTCCGGAAGGTTCCTTGTGGGAAGACTTACTGTTATGACCTAAGAATGTTAATCT GA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019758 |
Insert Size | 912 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC038899, AAH38899 |
RefSeq Size | 1103 bp |
RefSeq ORF | 912 bp |
Locus ID | 56428 |
UniProt ID | Q791V5 |
Cytogenetics | 2 E1 |
Gene Summary | This gene encodes a member of the SLC25 family of nuclear-encoded transporters that are localized in the inner mitochondrial membrane. Members of this superfamily are involved in many metabolic pathways and cell functions. Genome-wide association studies in human have identified single-nucleotide polymorphisms in several loci associated with obesity. This gene is one such locus, which is highly expressed in white adipose tissue and adipocytes, and thought to play a regulatory role in adipocyte differentiation and biology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target that can produce two isoforms from the same mRNA by use of alternative in-frame translation termination codons. [provided by RefSeq, Dec 2017] Transcript Variant: This variant (1) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon, while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204242 | Mtch2 (tGFP-tagged) - Mouse mitochondrial carrier homolog 2 (C. elegans) (Mtch2), nuclear gene encoding mitochondrial protein |
USD 500.00 |
|
MR204242 | Mtch2 (Myc-DDK-tagged) - Mouse mitochondrial carrier homolog 2 (C. elegans) (Mtch2), nuclear gene encoding mitochondrial protein |
USD 300.00 |
|
MR204242L3 | Lenti ORF clone of Mtch2 (Myc-DDK-tagged) - Mouse mitochondrial carrier homolog 2 (C. elegans) (Mtch2), nuclear gene encoding mitochondrial protein |
USD 600.00 |
|
MR204242L4 | Lenti ORF clone of Mtch2 (mGFP-tagged) - Mouse mitochondrial carrier homolog 2 (C. elegans) (Mtch2), nuclear gene encoding mitochondrial protein |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review