Cxcl11 (NM_019494) Mouse Untagged Clone
CAT#: MC210014
Cxcl11 (untagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1, (10ug)
"NM_019494" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cxcl11 |
Synonyms | b-R1; betaR1; Cxc11; H174; I-tac; Ip9; Itac; Scyb9b; Scyb11 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210014 representing NM_019494
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACAGGAAGGTCACAGCCATAGCCCTGGCTGCGATCATCTGGGCCACAGCTGCTCAAGGCTTCCTTA TGTTCAAACAGGGGCGCTGTCTTTGCATCGGCCCCGGGATGAAAGCCGTCAAAATGGCAGAGATCGAGAA AGCTTCTGTAATTTACCCGAGTAACAGCTGCGACAAAGTTGAAGTGATTGTTACTATGAAGGCTCATAAA CGACAAAGGTGCCTGGACCCCAGATCCAAGCAAGCTCGCCTCATAATGCAGGCAATAGAAAAAAAGAATT TTTTAAGGCGTCAAAACATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019494 |
Insert Size | 303 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC025903, AAH25903 |
RefSeq Size | 969 bp |
RefSeq ORF | 303 bp |
Locus ID | 56066 |
UniProt ID | Q9JHH5 |
Cytogenetics | 5 E2 |
Gene Summary | Chemotactic for interleukin-activated T-cells but not unstimulated T-cells, neutrophils or monocytes. Induces calcium release in activated T-cells. Binds to CXCR3. May play an important role in CNS diseases which involve T-cell recruitment. May play a role in skin immune responses (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1, coding) represents the shorter transcript but encodes the functional protein. This variant, which is based on a transcript from the BALB/c mouse strain, includes a 1-nt insertion in the 5'-most exon compared to the reference genome sequence, which represents a null mutant allele (C57BL/6 strain). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222244 | Cxcl11 (tGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), (10ug) |
USD 350.00 |
|
MR222244 | Cxcl11 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1 |
USD 150.00 |
|
MR222244L3 | Lenti ORF clone of Cxcl11 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1 |
USD 450.00 |
|
MR222244L4 | Lenti ORF clone of Cxcl11 (mGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review