Prdx5 (NM_012021) Mouse Untagged Clone
CAT#: MC209991
Prdx5 (untagged) - Mouse peroxiredoxin 5 (Prdx5), nuclear gene encoding mitochondrial protein, (10ug)
"NM_012021" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Prdx5 |
Synonyms | AOEB1; AOEB166; AOPP; P; PLP; PMP; Pmp20; Prd; Prdx6; PrxV |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209991 representing NM_012021
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTACAGCTGGGGCTTCGAGTCCTGGGCTGCAAAGCCAGTTCTGTGCTCCGTGCATCGACGTGCTTGG CAGGCAGAGCAGGCCGGAAAGAAGCAGGTTGGGAGTGTGGCGGAGCCCGCAGCTTCAGCAGCTCCGCGGT GACCATGGCCCCGATCAAGGTGGGAGATGCCATTCCCTCAGTGGAGGTATTTGAAGGGGAACCGGGAAAG AAGGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAAGGTGTTTTGTTTGGAGTCCCTGGGGCATTTACAC CTGGCTGTTCTAAGACCCACCTGCCTGGGTTTGTGGAGCAAGCTGGAGCTCTGAAGGCCAAGGGAGCGCA GGTGGTGGCCTGTCTGAGCGTTAATGACGTCTTTGTGATTGAAGAGTGGGGTCGAGCCCACCAGGCAGAA GGCAAGGTTCGGCTCCTGGCTGACCCCACTGGAGCCTTTGGGAAGGCGACAGACTTATTATTGGATGATT CTTTGGTGTCTCTCTTTGGGAATCGTCGGCTGAAAAGGTTCTCCATGGTGATAGACAACGGCATAGTGAA GGCACTGAACGTGGAGCCAGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCTCAACTC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_012021 |
Insert Size | 633 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC008174, AAH08174 |
RefSeq Size | 1218 bp |
RefSeq ORF | 633 bp |
Locus ID | 54683 |
UniProt ID | P99029 |
Cytogenetics | 19 5.08 cM |
Gene Summary | This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein plays an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. The use of alternate transcription start sites may result in use of alternate in-frame translation start codons that generate alternate isoforms that are targeted to the mitochondrion or peroxisome/cytoplasm. [provided by RefSeq, Nov 2017] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224040 | Prdx5 (tGFP-tagged) - Mouse peroxiredoxin 5 (Prdx5) nuclear gene encoding mitochondrial protein, (10ug) |
USD 650.00 |
|
MR224040 | Prdx5 (Myc-DDK-tagged) - Mouse peroxiredoxin 5 (Prdx5), nuclear gene encoding mitochondrial protein |
USD 450.00 |
|
MR224040L1 | Lenti ORF clone of Prdx5 (Myc-DDK-tagged) - Mouse peroxiredoxin 5 (Prdx5), nuclear gene encoding mitochondrial protein |
USD 750.00 |
|
MR224040L2 | Lenti ORF clone of Prdx5 (mGFP-tagged) - Mouse peroxiredoxin 5 (Prdx5), nuclear gene encoding mitochondrial protein |
USD 750.00 |
|
MR224040L3 | Lenti ORF clone of Prdx5 (Myc-DDK-tagged) - Mouse peroxiredoxin 5 (Prdx5), nuclear gene encoding mitochondrial protein |
USD 750.00 |
|
MR224040L4 | Lenti ORF clone of Prdx5 (mGFP-tagged) - Mouse peroxiredoxin 5 (Prdx5), nuclear gene encoding mitochondrial protein |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review