Cpsf4 (NM_178576) Mouse Untagged Clone

CAT#: MC209957

Cpsf4 (untagged) - Mouse cleavage and polyadenylation specific factor 4 (Cpsf4), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cpsf4
• Synonyms: 30kDa; C79664
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209957 representing NM_178576
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGGAAATAATCGCCAGCGTAGATCACATCAAGTTCGACTTGGAGATCGCCGTGGAGCAGCAGCTCG
  GGGCGCAGCCGCTGCCCTTCCCCGGCATGGATAAGTCGGGGGCTGCTGTCTGTGAATTCTTTTTGAAAGC
  CGCCTGTGGCAAAGGGGGCATGTGTCCATTCCGCCACATCAGTGGTGAGAAGACAGTTGTGTGCAAACAC
  TGGCTGAGAGGACTGTGCAAGAAAGGGGACCAGTGTGAGTTCTTGCATGAATATGACATGACCAAGATGC
  CTGAGTGCTACTTTTACTCCAAGTTCGGTCCCCTGTGTAGGCATCGGCACACCCGGAGAGTCATTTGTGT
  GAACTACCTTGTTGGATTCTGCCCTGAGGGACCATCATGTAAATTCATGCACCCTCGATTTGAACTGCCC
  ATGGGAACCACTGAGCAACCCCCACTACCGCAGCAGACACAGCCTCCAACAAAGAGAGCCCCGCAGGTCA
  TTGGGGTCATGCAGAGTCAAAACAGCAGTGCAGGCAACCGGGGACCCCGGCCGCTGGAGCAAGTCACTTG
  CTACAAGTGTGGTGAGAAAGGACACTACGCCAACAGATGCACCAAAGGGCATTTGGCCTTTCTCAGTGGG
  CAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_178576
• Insert Size: 636 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_178576.3, NP_848671.1
• RefSeq Size: 1626 bp
• RefSeq ORF: 636 bp
• Locus ID: 54188
• UniProt ID: Q8BQZ5
• Cytogenetics: 5 G2
• Gene Summary: Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other factors to bring about cleavage and poly(A) addition. CPSF4 binds RNA polymers with a preference for poly(U) (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon in the central coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (c) is shorter than isoform a.