Foxl2 (NM_012020) Mouse Untagged Clone

CAT#: MC209752

Foxl2 (untagged) - Mouse forkhead box L2 (Foxl2), (10ug)

USD 402


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Foxl2 (NM_012020) Mouse Untagged Clone
Symbol Foxl2
Synonyms AU045128; BPES; Pfrk; PINTO
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC209752 representing NM_012020
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGCCAGCTACCCCGAGCCCGAAGACACGGCGGGGACCCTGCTGGCTCCGGAGAGCGGACGCGCAG
TCAAAGAGGCCGAGGCGTCGCCGCCGAGTCCCGGCAAGGGAGGCGGGACAACACCGGAGAAACCAGACCC
CGCGCAGAAGCCCCCGTACTCGTACGTGGCGCTCATCGCCATGGCGATCCGCGAGAGCGCCGAGAAGAGG
CTCACTCTGTCCGGCATCTACCAGTACATCATAGCCAAGTTCCCGTTCTACGAGAAGAACAAGAAGGGCT
GGCAGAATAGCATCCGCCACAACCTCAGCCTCAACGAGTGCTTCATCAAGGTGCCGCGCGAGGGCGGCGG
CGAGCGCAAGGGCAACTACTGGACGCTCGACCCGGCCTGCGAGGACATGTTCGAGAAGGGCAACTACCGG
CGCCGCCGCCGCATGAAGCGGCCCTTCCGGCCGCCGCCCGCTCACTTCCAGCCCGGCAAGGGGCTCTTCG
GGAGCGGAGGAGCGGCGGGTGGCTGCGGCGTGCCCGGAGCTGGGGCCGATGGCTATGGCTACCTGGCGCC
ACCCAAGTACCTGCAATCGGGGTTCCTCAACAACTCCTGGCCCCTGCCGCAGCCTCCCTCGCCCATGCCC
TACGCCTCCTGCCAGATGGCGGCGGCTGCGGCGGCCGCTGCTGCAGCCGCTGCAGCCGCCGGCCCGGGCA
GCCCCGGTGCAGCCGCGGTGGTCAAGGGGCTGGCGGGCCCCGCCGCCTCCTACGGGCCGTACTCGCGCGT
GCAGAGCATGGCGCTGCCTCCGGGCGTCGTGAACTCCTACAACGGCCTGGGGGGCCCTCCTGCCGCACCA
CCGCCGCCGCCACCGCCGCCGCACCCTCACCCGCACCCTCACGCACATCATCTGCACGCGGCCGCTGCGC
CCCCGCCAGCCCCGCCACACCACGGGGCTGCCGCGCCTCCCCCGGGTCAGCTCAGTCCCGCCAGCCCGGC
CACCGCCGCGCCCCCGGCACCCGCGCCCACGAGCGCGCCCGGCCTGCAGTTCGCCTGCGCCCGGCAACCC
GAGCTCGCCATGATGCATTGCTCATACTGGGACCACGACAGCAAGACGGGCGCGCTGCACTCGCGTCTGG
ATCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_012020
ORF Size 1128 bp
Insert Size 1128
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_012020.2, NP_036150
RefSeq Size 2520
RefSeq ORF 1128
Locus ID 26927
Cytogenetics 9|9 E3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.