Rcn2 (NM_011992) Mouse Untagged Clone

CAT#: MC209742

Rcn2 (untagged) - Mouse reticulocalbin 2 (Rcn2), (10ug)


  "NM_011992" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rcn2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rcn2
Synonyms AA408742; Tcbp49
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209742 representing NM_011992
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGCTGGGCCCAAGGCCCGCGGCGCTAGGACTGCTGCTGCCGCTGCTGCTGTACGCCGCGGTGGCTG
GCGCCAGCAAGGCGGAGGAACTGCACTACCCGCAGGGCGAGCACCGGGCGGACTACGACCGCGAAGCGCT
GCTGGGTGTCCAGGAAGACGTCGATGAGTATGTTAAACTTGGCCACGAAGAGCAGCAAAGACGATTGCAG
TCGATCATAAAGAAAATTGACTCGGACTCTGATGGCTTTCTTACTGAAAATGAACTCAGTCAGTGGATTC
AGATGTCTTTTAAGCATTACGCTATGCAAGAAGCCAAGCAGCAGTTTGTGGAGTATGATAAGAACAGCGA
CGGCGCTGTGACGTGGGATGAGTACAACATCCAGATGTACGACCGGGTGATTGACTTTGATGAGAACACT
GCTCTGGATGACACAGAAGAGGGGTCGTTCAGGCAGCTTCATCTAAAGGATAAGAAGCGATTTGAAAAAG
CTAACCAGGATTCAGGTCCTGGTCTGAGTCTTGAAGAGTTCATTGCGTTTGAGCACCCTGAAGAAGTTGA
CTATATGACGGAGTTCGTCATCCAAGAGGCTTTGGAAGAACATGACAAAAATGGCGATGGGTTTGTTAGT
TTGGAAGAATTTCTTGGCGATTACAGGCGGGATCCAACTGCAAATGAAGACCCAGAATGGATACTTGTTG
AAAAGGACAGATTTGTGAATGATTATGACAAAGATAATGATGGCCGGCTTGATCCCCAAGAGCTGTTGTC
ATGGGTAGTGCCCAATAACCAGGGCATTGCACAAGAGGAAGCTCTTCATCTGATTGATGAGATGGATTTG
AATAGTGACAAAAAGCTCTCTGAAGAAGAGATTCTGGAAAACCAAGACTTGTTCCTTACCAGCGAAGCCA
CGGATTATGGCCGACAGCTCCATGACGACTACTTCTATCATGACGAGCTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011992
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011992.2, NP_036122.2
RefSeq Size 2042 bp
RefSeq ORF 963 bp
Locus ID 26611
UniProt ID Q8BP92
Cytogenetics 9 B
Gene Summary Not known. Binds calcium (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). CCDS Note: This CCDS representation uses a downstream start codon that is well-conserved in mammalian organisms. It also contains an upstream in-frame start codon that would result in a 35 aa N-terminal extension. However, this upstream start codon is only present in mouse and rat, and its use would eliminate an N-terminal signal peptide that is only predicted in the shorter N-terminus. N-terminal sequencing of the rat protein in PMID:7722520 indicates signal peptide cleavage. It is likely that the upstream start codon is skipped due to leaky scanning by ribosomes, thereby permitting translation initiation at the currently represented start codon.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.