Rbbp6 (NM_175023) Mouse Untagged Clone

CAT#: MC209298

Rbbp6 (untagged) - Mouse retinoblastoma binding protein 6 (Rbbp6), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rbbp6
• Synonyms: 4933422O15Rik; AI316869; BB233631; C030034J04Rik; C77662; P2P-R; PACT
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209298 representing NM_175023
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCTGTGTGCACTATAAATTTTCCTCTAAACTCAACTACGACACCGTCACTTTTGATGGGCTCCATA
  TCTCCCTCTGCGATTTAAAGAAGCAGATTATGGGGAGAGAAAAGCTGAAAGCTGCCGATAGCGATCTGCA
  GATCACCAACGCACAGACGAAAGAAGAATACACTGATGACAATGCGCTCATTCCTAAGAACTCATCTGTG
  ATTGTCAGGAGGATTCCTATTGGAGGTGTCAAGTCTACAAGCAAGACATATGTTATAAGTCGAACTGAAC
  CAGTGATGGGAACTACAAAAGCAGTATGTAAAAACACAATCACCCTTTTTCTACACAATTGCTTTTACCT
  TTATAATGTTTCAGTGACGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_175023
• Insert Size: 372 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_175023.3, NP_778188.1
• RefSeq Size: 2272 bp
• RefSeq ORF: 372 bp
• Locus ID: 19647
• UniProt ID: P97868
• Cytogenetics: 7 F2
• Gene Summary: E3 ubiquitin-protein ligase which promotes ubiquitination of YBX1, leading to its degradation by the proteasome (By similarity). May play a role as a scaffold protein to promote the assembly of the p53/TP53-MDM2 complex, resulting in increase of MDM2-mediated ubiquitination and degradation of p53/TP53; may function as negative regulator of p53/TP53, leading to both apoptosis and cell growth retardation (PubMed:17470788). Regulates DNA-replication and common fragile sites (CFS) stability in a ZBTB38- and MCM10-dependent manner. Controls ZBTB38 protein stability and abundance via ubiquitination and proteasomal degradation, and ZBTB38 in turn negatively regulates the expression of MCM10 which plays an important role in DNA-replication (PubMed:24726359).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks most 3' exons and has an alternate 3' segment, as compared to variant 1. The resulting isoform 2 is much shorter than isoform 1.