Qk (NM_021881) Mouse Untagged Clone

CAT#: MC209268

Qk (untagged) - Mouse quaking (Qk), transcript variant 3, (10ug)


  "NM_021881" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Qk
Synonyms 1110003F05Rik; 1500005P18; l(17)-1Wis; l17Wis1; QkI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209268 representing NM_021881
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCGGGGAAATGGAAACGAAGGAGAAGCCGAAGCCCACCCCAGATTATTTGATGCAGCTGATGAACG
ACAAGAAGCTCATGAGCAGCCTGCCCAACTTCTGCGGGATCTTCAACCACCTCGAGCGGCTGCTGGACGA
AGAAATTAGCAGAGTACGGAAAGACATGTACAATGACACGTTAAATGGCAGTACAGAGAAAAGAAGTGCA
GAATTGCCTGACGCGGTGGGACCCATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACC
CTGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCTAAACAACTTGAAGCAGAAAC
GGGATGTAAAATAATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAGAAGGAGGAGCAAAATAGAGGC
AAGCCCAATTGGGAGCATCTAAATGAAGACTTACATGTACTAATCACTGTGGAAGATGCTCAGAACAGAG
CAGAAATCAAGCTGAAGAGAGCGGTTGAAGAAGTGAAGAAGTTACTGGTACCTGCGGCTGAAGGTGAAGA
CAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCAATTCTGAATGGCACCTACAGAGACGCCAACATTAAA
TCACCAGCCCTTGCCTTTTCTCTTGCAGCAACTGCCCAGGCTGCTCCAAGGATCATCACTGGGCCTGCGC
CTGTCCTCCCACCAGCTGCTCTGCGTACACCTACGCCAGCTGGCCCTACCATAATGCCTTTGATCAGACA
AATACAGACCGCTGTCATGCCAAACGGAACTCCTCACCCAACTGCTGCAATAGTCCCTCCAGGGCCTGAA
GCTGGGTTAATCTACACACCCTATGAATACCCCTACACATTGGCACCAGCTACATCAATCCTTGAGTACC
CTATTGAACCCAGTGGTGTGTTAGAGTGGATTGAAATGCCAGTCATGCCTGATATTTCAGCCCATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021881
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021881.2, NP_068681.1
RefSeq Size 6718 bp
RefSeq ORF 978 bp
Locus ID 19317
UniProt ID Q9QYS9
Cytogenetics 17 7.75 cM
Gene Summary RNA-binding protein that plays a central role in myelinization (PubMed:10864952, PubMed:11917126). Also required for visceral endoderm function and blood vessel development (PubMed:11892011, PubMed:16470614). Binds to the 5'-NACUAAY-N(1,20)-UAAY-3' RNA core sequence (PubMed:16041388). Acts by regulating pre-mRNA splicing, mRNA export, mRNA stability and protein translation, as well as cellular processes including apoptosis, cell cycle, glial cell fate and development (PubMed:10535969, PubMed:12467586, PubMed:11297509, PubMed:11917126, PubMed:15568022). Required to protect and promote stability of mRNAs such as MBP and CDKN1B which promotes oligodendrocyte differentiation (PubMed:10535969, PubMed:15568022). Participates in mRNA transport by regulating the nuclear export of MBP mRNA (PubMed:12467586). May also play a role in smooth muscle development (PubMed:14706070).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.