Nthl1 (NM_008743) Mouse Untagged Clone

CAT#: MC209061

Nthl1 (untagged) - Mouse nth (endonuclease III)-like 1 (E.coli) (Nthl1), (10ug)


  "NM_008743" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nthl1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nthl1
Synonyms Nth1; Octs3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209061 representing NM_008743
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACTCAGGGGTGCGGATGGTGACTCGCAGTCGGAGCCGCGCGACTAGGATCGCGTCGGAAGGGTGTA
GGGAGGAGCTCGCCCCGCGAGAGGCTGCTGCAGAAGGAAGAAAAAGCCACAGGCCCGTGAGACATCCACG
GAGAACACAGAAAACGCATGTGGCCTATGAAGCGGCTAATGGTGAGGAAGGCGAAGATGCTGAGCCCCTC
AAAGTGCCCGTTTGGGAGCCCCAGAACTGGCAGCAGCAACTGGCCAACATCCGCATCATGAGAAGCAAGA
AGGATGCACCTGTGGACCAGCTAGGCGCCGAGCACTGCTATGATGCAAGTGCCTCCCCGAAGGTGAGGAG
GTACCAGGTACTCCTGTCGCTGATGCTCTCCAGCCAGACCAAAGACCAGGTCACAGCAGGTGCTATGCAA
CGGCTCCGGGCCCGGGGCTTGACTGTGGAGAGCATCCTGCAGACCGATGATGACACGCTAGGCAGACTCA
TCTACCCTGTGGGCTTCTGGAGGAACAAGGTAAAATACATCAAGCAGACAACCGCCATCCTGCAGCAGCG
CTACGAAGGGGACATCCCTGCTTCCGTGGCTGAGCTGGTAGCCTTGCCAGGTGTTGGGCCCAAGATGGCA
CACTTGGCTATGGCTGTGGCCTGGGGGACCATATCAGGCATAGCAGTGGACACACATGTGCACAGAATAG
CCAACCGACTGAGGTGGACCAAGAAGATGACCAAGACCCCAGAAGAGACACGTAAGAACTTGGAAGAGTG
GCTACCCAGGGTGCTGTGGAGTGAGGTCAACGGACTACTGGTAGGCTTCGGCCAACAGATCTGTCTTCCT
GTCCATCCTCGATGTCAGGCTTGCCTCAACAAGGCCCTGTGCCCTGCTGCCCAGGATCTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008743
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008743.2, NP_032769.2
RefSeq Size 1080 bp
RefSeq ORF 903 bp
Locus ID 18207
UniProt ID O35980
Cytogenetics 17 A3.3
Gene Summary Bifunctional DNA N-glycosylase with associated apurinic/apyrimidinic (AP) lyase function that catalyzes the first step in base excision repair (BER), the primary repair pathway for the repair of oxidative DNA damage. The DNA N-glycosylase activity releases the damaged DNA base from DNA by cleaving the N-glycosidic bond, leaving an AP site. The AP lyase activity cleaves the phosphodiester bond 3' to the AP site by a beta-elimination. Primarily recognizes and repairs oxidative base damage of pyrimidines.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.